FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623429_at:

>probe:Drosophila_2:1623429_at:408:181; Interrogation_Position=3400; Antisense; AAAACGGAGACTGTTGCACCTCCAG
>probe:Drosophila_2:1623429_at:76:283; Interrogation_Position=3419; Antisense; CTCCAGCTAGCAACACCGGGAAGTA
>probe:Drosophila_2:1623429_at:546:259; Interrogation_Position=3444; Antisense; CACGGGAGGATTTGGTGCACCGCCT
>probe:Drosophila_2:1623429_at:155:11; Interrogation_Position=3509; Antisense; ATTCGGGACCCAATTCCAATCCGAG
>probe:Drosophila_2:1623429_at:96:573; Interrogation_Position=3538; Antisense; GGCTCCGACATCTATGTGGCTGGCA
>probe:Drosophila_2:1623429_at:9:523; Interrogation_Position=3553; Antisense; GTGGCTGGCAACCAACACGAGTTCA
>probe:Drosophila_2:1623429_at:26:387; Interrogation_Position=3594; Antisense; GAACAAGGCGCGACCCACCGTGAAT
>probe:Drosophila_2:1623429_at:709:233; Interrogation_Position=3616; Antisense; AATCCGGGTCGCTACAACGGCGGAT
>probe:Drosophila_2:1623429_at:410:139; Interrogation_Position=3652; Antisense; ACGGGAGTTCTTTCGCCTCAAGCGC
>probe:Drosophila_2:1623429_at:333:717; Interrogation_Position=3694; Antisense; TTCCAGCCAATTAACCAGCGAACGG
>probe:Drosophila_2:1623429_at:292:81; Interrogation_Position=3724; Antisense; AGGGAACAGTCATCCGGTGGCAACA
>probe:Drosophila_2:1623429_at:572:599; Interrogation_Position=3756; Antisense; TGAGAGCCGTTTTGGTGGACCGCCT
>probe:Drosophila_2:1623429_at:279:567; Interrogation_Position=3831; Antisense; GGCAGTCCAGGAGTTCGCAAATACT
>probe:Drosophila_2:1623429_at:259:489; Interrogation_Position=3876; Antisense; GTACATGTACCTATGCTAGAGCTAA

Paste this into a BLAST search page for me
AAAACGGAGACTGTTGCACCTCCAGCTCCAGCTAGCAACACCGGGAAGTACACGGGAGGATTTGGTGCACCGCCTATTCGGGACCCAATTCCAATCCGAGGGCTCCGACATCTATGTGGCTGGCAGTGGCTGGCAACCAACACGAGTTCAGAACAAGGCGCGACCCACCGTGAATAATCCGGGTCGCTACAACGGCGGATACGGGAGTTCTTTCGCCTCAAGCGCTTCCAGCCAATTAACCAGCGAACGGAGGGAACAGTCATCCGGTGGCAACATGAGAGCCGTTTTGGTGGACCGCCTGGCAGTCCAGGAGTTCGCAAATACTGTACATGTACCTATGCTAGAGCTAA

Full Affymetrix probeset data:

Annotations for 1623429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720