FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623430_at:

>probe:Drosophila_2:1623430_at:265:61; Interrogation_Position=1456; Antisense; ATGTAGATAATTCGCGAGAGCCGCT
>probe:Drosophila_2:1623430_at:71:655; Interrogation_Position=1463; Antisense; TAATTCGCGAGAGCCGCTGGAGATC
>probe:Drosophila_2:1623430_at:255:425; Interrogation_Position=1471; Antisense; GAGAGCCGCTGGAGATCCTATTGAA
>probe:Drosophila_2:1623430_at:334:319; Interrogation_Position=1475; Antisense; GCCGCTGGAGATCCTATTGAATGGA
>probe:Drosophila_2:1623430_at:448:305; Interrogation_Position=1487; Antisense; CCTATTGAATGGATTTGGGAGCACT
>probe:Drosophila_2:1623430_at:451:19; Interrogation_Position=1499; Antisense; ATTTGGGAGCACTTAGCTGATCGCC
>probe:Drosophila_2:1623430_at:323:553; Interrogation_Position=1504; Antisense; GGAGCACTTAGCTGATCGCCGCAAG
>probe:Drosophila_2:1623430_at:143:259; Interrogation_Position=1508; Antisense; CACTTAGCTGATCGCCGCAAGGTTA
>probe:Drosophila_2:1623430_at:140:119; Interrogation_Position=1513; Antisense; AGCTGATCGCCGCAAGGTTAATCTC
>probe:Drosophila_2:1623430_at:561:605; Interrogation_Position=1516; Antisense; TGATCGCCGCAAGGTTAATCTCCTT
>probe:Drosophila_2:1623430_at:142:361; Interrogation_Position=1524; Antisense; GCAAGGTTAATCTCCTTCCCATTCG
>probe:Drosophila_2:1623430_at:359:71; Interrogation_Position=1527; Antisense; AGGTTAATCTCCTTCCCATTCGTCG
>probe:Drosophila_2:1623430_at:262:11; Interrogation_Position=1544; Antisense; ATTCGTCGCGCATAGCAGGAACCAG
>probe:Drosophila_2:1623430_at:457:323; Interrogation_Position=1551; Antisense; GCGCATAGCAGGAACCAGCGATCAG

Paste this into a BLAST search page for me
ATGTAGATAATTCGCGAGAGCCGCTTAATTCGCGAGAGCCGCTGGAGATCGAGAGCCGCTGGAGATCCTATTGAAGCCGCTGGAGATCCTATTGAATGGACCTATTGAATGGATTTGGGAGCACTATTTGGGAGCACTTAGCTGATCGCCGGAGCACTTAGCTGATCGCCGCAAGCACTTAGCTGATCGCCGCAAGGTTAAGCTGATCGCCGCAAGGTTAATCTCTGATCGCCGCAAGGTTAATCTCCTTGCAAGGTTAATCTCCTTCCCATTCGAGGTTAATCTCCTTCCCATTCGTCGATTCGTCGCGCATAGCAGGAACCAGGCGCATAGCAGGAACCAGCGATCAG

Full Affymetrix probeset data:

Annotations for 1623430_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720