Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623431_at:

>probe:Drosophila_2:1623431_at:363:97; Interrogation_Position=1043; Antisense; AGATCATGGTGACTTCTCTGGAAGG
>probe:Drosophila_2:1623431_at:310:31; Interrogation_Position=1070; Antisense; ATAAACCCGTTTGGATGGCCTGCGA
>probe:Drosophila_2:1623431_at:587:371; Interrogation_Position=1116; Antisense; GAAGTCCGGTCCATTAAGCCTGAGA
>probe:Drosophila_2:1623431_at:712:575; Interrogation_Position=1177; Antisense; GGCGAGTCGCTCACCAAAGCAGAGA
>probe:Drosophila_2:1623431_at:559:717; Interrogation_Position=1205; Antisense; TTGACTACAGAGCATCCCGACGGGA
>probe:Drosophila_2:1623431_at:477:461; Interrogation_Position=1256; Antisense; GATTGGACACCTTGAAACAGCCCGT
>probe:Drosophila_2:1623431_at:423:321; Interrogation_Position=1275; Antisense; GCCCGTACAGTTTCGCTTCATAAAT
>probe:Drosophila_2:1623431_at:618:47; Interrogation_Position=1298; Antisense; ATGCTTCTACAATTGGCGAGTCTCC
>probe:Drosophila_2:1623431_at:213:313; Interrogation_Position=1324; Antisense; GCCACCGGAGGTCTTAATGAACACG
>probe:Drosophila_2:1623431_at:677:133; Interrogation_Position=1436; Antisense; ACGCTTTTGAGATTGTAGTCCACGA
>probe:Drosophila_2:1623431_at:46:725; Interrogation_Position=1466; Antisense; TTGTCCCATCGGGTGTTTTACATGC
>probe:Drosophila_2:1623431_at:413:391; Interrogation_Position=1509; Antisense; GAAAGAACTGCCTGCTTGGGATCCC
>probe:Drosophila_2:1623431_at:552:45; Interrogation_Position=1529; Antisense; ATCCCATGGGCGCATTACTTAATTA
>probe:Drosophila_2:1623431_at:75:147; Interrogation_Position=1602; Antisense; ACTACATTTTATTTGCCTTCTTGAA

Paste this into a BLAST search page for me
AGATCATGGTGACTTCTCTGGAAGGATAAACCCGTTTGGATGGCCTGCGAGAAGTCCGGTCCATTAAGCCTGAGAGGCGAGTCGCTCACCAAAGCAGAGATTGACTACAGAGCATCCCGACGGGAGATTGGACACCTTGAAACAGCCCGTGCCCGTACAGTTTCGCTTCATAAATATGCTTCTACAATTGGCGAGTCTCCGCCACCGGAGGTCTTAATGAACACGACGCTTTTGAGATTGTAGTCCACGATTGTCCCATCGGGTGTTTTACATGCGAAAGAACTGCCTGCTTGGGATCCCATCCCATGGGCGCATTACTTAATTAACTACATTTTATTTGCCTTCTTGAA

Full Affymetrix probeset data:

Annotations for 1623431_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime