Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623434_at:

>probe:Drosophila_2:1623434_at:389:319; Interrogation_Position=1793; Antisense; GCCGCAGCTATTCATCAACTACAAG
>probe:Drosophila_2:1623434_at:85:161; Interrogation_Position=1813; Antisense; ACAAGCTAAAGTCGGTGGCCCACAT
>probe:Drosophila_2:1623434_at:290:577; Interrogation_Position=1843; Antisense; GGCGCATGATGACCTACAAGTTCCT
>probe:Drosophila_2:1623434_at:483:93; Interrogation_Position=1861; Antisense; AGTTCCTCAACACCTTTATCGATGA
>probe:Drosophila_2:1623434_at:304:445; Interrogation_Position=1881; Antisense; GATGACATCTTTGCGTTTGTGATCA
>probe:Drosophila_2:1623434_at:431:215; Interrogation_Position=1913; Antisense; CACAATGTACCGGTTGGGTTGCTTC
>probe:Drosophila_2:1623434_at:721:409; Interrogation_Position=1941; Antisense; GACGACATCATCTTCTTTGTGTTCC
>probe:Drosophila_2:1623434_at:54:125; Interrogation_Position=1972; Antisense; AGCGCTGGCAGTATCGCGTCGATTT
>probe:Drosophila_2:1623434_at:234:327; Interrogation_Position=1987; Antisense; GCGTCGATTTGAAGCGCGTGAATGA
>probe:Drosophila_2:1623434_at:302:329; Interrogation_Position=2002; Antisense; GCGTGAATGAGTTCGGCTTCTCCGG
>probe:Drosophila_2:1623434_at:178:229; Interrogation_Position=2076; Antisense; AATGGAGCCATCGAAGGTCCCCAGG
>probe:Drosophila_2:1623434_at:451:371; Interrogation_Position=2147; Antisense; GAAGGAGTGCAGAGCTGTGACCACA
>probe:Drosophila_2:1623434_at:378:285; Interrogation_Position=2161; Antisense; CTGTGACCACAGTATGCATTAGCAT
>probe:Drosophila_2:1623434_at:165:105; Interrogation_Position=2190; Antisense; AGACGCAATACCATATACTCCACTC

Paste this into a BLAST search page for me
GCCGCAGCTATTCATCAACTACAAGACAAGCTAAAGTCGGTGGCCCACATGGCGCATGATGACCTACAAGTTCCTAGTTCCTCAACACCTTTATCGATGAGATGACATCTTTGCGTTTGTGATCACACAATGTACCGGTTGGGTTGCTTCGACGACATCATCTTCTTTGTGTTCCAGCGCTGGCAGTATCGCGTCGATTTGCGTCGATTTGAAGCGCGTGAATGAGCGTGAATGAGTTCGGCTTCTCCGGAATGGAGCCATCGAAGGTCCCCAGGGAAGGAGTGCAGAGCTGTGACCACACTGTGACCACAGTATGCATTAGCATAGACGCAATACCATATACTCCACTC

Full Affymetrix probeset data:

Annotations for 1623434_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime