FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623437_at:

>probe:Drosophila_2:1623437_at:320:461; Interrogation_Position=1013; Antisense; GATTAGGGCCGCTTGGAACTGCTCG
>probe:Drosophila_2:1623437_at:272:383; Interrogation_Position=1028; Antisense; GAACTGCTCGGATAAGGTCTCGATT
>probe:Drosophila_2:1623437_at:176:19; Interrogation_Position=1154; Antisense; ATTTCTTGGCGCGTGTGTTAACATC
>probe:Drosophila_2:1623437_at:480:115; Interrogation_Position=678; Antisense; AGCATTTCTGCTCAAGTGCCAGCTG
>probe:Drosophila_2:1623437_at:383:623; Interrogation_Position=701; Antisense; TGCGTGCCTTGAGTAATCAGTCCGT
>probe:Drosophila_2:1623437_at:122:505; Interrogation_Position=720; Antisense; GTCCGTGGAGGACCTTAGCATCTAG
>probe:Drosophila_2:1623437_at:86:675; Interrogation_Position=735; Antisense; TAGCATCTAGTTTCCAGTTCACATA
>probe:Drosophila_2:1623437_at:179:661; Interrogation_Position=801; Antisense; TAAACCTTGCACTTGTCCAATTCCA
>probe:Drosophila_2:1623437_at:257:313; Interrogation_Position=831; Antisense; GCCACTTTCGGCTTGACAATGAACT
>probe:Drosophila_2:1623437_at:319:397; Interrogation_Position=845; Antisense; GACAATGAACTGATCGCGCGGCAAA
>probe:Drosophila_2:1623437_at:96:625; Interrogation_Position=921; Antisense; TGCGCGTAATCATCACAGTTCATCT
>probe:Drosophila_2:1623437_at:496:93; Interrogation_Position=937; Antisense; AGTTCATCTCGAAGAAGCGGCGCCA
>probe:Drosophila_2:1623437_at:672:225; Interrogation_Position=963; Antisense; AAGGCGCAGGCCAAAACCCGATCGT
>probe:Drosophila_2:1623437_at:11:607; Interrogation_Position=994; Antisense; TGATGCCCTCGTCGTAGGCGATTAG

Paste this into a BLAST search page for me
GATTAGGGCCGCTTGGAACTGCTCGGAACTGCTCGGATAAGGTCTCGATTATTTCTTGGCGCGTGTGTTAACATCAGCATTTCTGCTCAAGTGCCAGCTGTGCGTGCCTTGAGTAATCAGTCCGTGTCCGTGGAGGACCTTAGCATCTAGTAGCATCTAGTTTCCAGTTCACATATAAACCTTGCACTTGTCCAATTCCAGCCACTTTCGGCTTGACAATGAACTGACAATGAACTGATCGCGCGGCAAATGCGCGTAATCATCACAGTTCATCTAGTTCATCTCGAAGAAGCGGCGCCAAAGGCGCAGGCCAAAACCCGATCGTTGATGCCCTCGTCGTAGGCGATTAG

Full Affymetrix probeset data:

Annotations for 1623437_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720