Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623438_at:

>probe:Drosophila_2:1623438_at:586:711; Interrogation_Position=1737; Antisense; TTCGTGCCGTACTCCTACGTAAAGC
>probe:Drosophila_2:1623438_at:493:669; Interrogation_Position=1752; Antisense; TACGTAAAGCGTCCCTTCTTCGATG
>probe:Drosophila_2:1623438_at:148:493; Interrogation_Position=1879; Antisense; GTAATCTGCGTAACTTTAGCGACCA
>probe:Drosophila_2:1623438_at:206:729; Interrogation_Position=1905; Antisense; TTGGGCGAAGTGGAGCTCTACAACG
>probe:Drosophila_2:1623438_at:284:197; Interrogation_Position=1926; Antisense; AACGGAGCGGTTGGATGCCTGAACA
>probe:Drosophila_2:1623438_at:672:729; Interrogation_Position=1936; Antisense; TTGGATGCCTGAACAGCAGCGCTGT
>probe:Drosophila_2:1623438_at:236:603; Interrogation_Position=1958; Antisense; TGTTATGCTAAACGAGCGCACCTCC
>probe:Drosophila_2:1623438_at:113:573; Interrogation_Position=1999; Antisense; GGCTGGCCATGCAAACCTACGGTGG
>probe:Drosophila_2:1623438_at:377:669; Interrogation_Position=2016; Antisense; TACGGTGGCGACTGGCTCACTCGGT
>probe:Drosophila_2:1623438_at:482:409; Interrogation_Position=2091; Antisense; GACGAGGGCGACCAGTACCATGACT
>probe:Drosophila_2:1623438_at:548:91; Interrogation_Position=2158; Antisense; AGTTCGCAGAGGTGTTCCGGTGCCA
>probe:Drosophila_2:1623438_at:338:59; Interrogation_Position=2182; Antisense; ATGTTGGCTCCGGAATGACCAGCGC
>probe:Drosophila_2:1623438_at:65:129; Interrogation_Position=2209; Antisense; ACCAGTGTCCCTTCTGGTGAGGGAT
>probe:Drosophila_2:1623438_at:387:145; Interrogation_Position=2252; Antisense; ACTCCCACTGCTAGTCGGTGTATAG

Paste this into a BLAST search page for me
TTCGTGCCGTACTCCTACGTAAAGCTACGTAAAGCGTCCCTTCTTCGATGGTAATCTGCGTAACTTTAGCGACCATTGGGCGAAGTGGAGCTCTACAACGAACGGAGCGGTTGGATGCCTGAACATTGGATGCCTGAACAGCAGCGCTGTTGTTATGCTAAACGAGCGCACCTCCGGCTGGCCATGCAAACCTACGGTGGTACGGTGGCGACTGGCTCACTCGGTGACGAGGGCGACCAGTACCATGACTAGTTCGCAGAGGTGTTCCGGTGCCAATGTTGGCTCCGGAATGACCAGCGCACCAGTGTCCCTTCTGGTGAGGGATACTCCCACTGCTAGTCGGTGTATAG

Full Affymetrix probeset data:

Annotations for 1623438_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime