FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623439_at:

>probe:Drosophila_2:1623439_at:67:403; Interrogation_Position=329; Antisense; GACTACCGGGTGATCTTAAGGCCAT
>probe:Drosophila_2:1623439_at:139:217; Interrogation_Position=361; Antisense; AAGTTCGATTATGCCTATTCCGTTG
>probe:Drosophila_2:1623439_at:278:315; Interrogation_Position=373; Antisense; GCCTATTCCGTTGCAAAGCCTATAA
>probe:Drosophila_2:1623439_at:352:401; Interrogation_Position=448; Antisense; GACATGGAGGACTTTGTAACGCACC
>probe:Drosophila_2:1623439_at:685:649; Interrogation_Position=473; Antisense; TCAGCCGCCTGTGTAGCAAGAATCT
>probe:Drosophila_2:1623439_at:705:79; Interrogation_Position=508; Antisense; AGGGACCTATACGATCTGGCTTCGA
>probe:Drosophila_2:1623439_at:374:87; Interrogation_Position=599; Antisense; AGTCGCGAATTGCAAGTCTTAGGAA
>probe:Drosophila_2:1623439_at:322:637; Interrogation_Position=650; Antisense; TCGATGCCCACTTGGAGTCCGAAGA
>probe:Drosophila_2:1623439_at:478:147; Interrogation_Position=723; Antisense; ACTTGCCACGGGAACCAATGCTGAT
>probe:Drosophila_2:1623439_at:378:391; Interrogation_Position=745; Antisense; GATAAGGCCCGGACTTAAGCCAAAT
>probe:Drosophila_2:1623439_at:608:35; Interrogation_Position=772; Antisense; ATCAGGAAGTCATCTCACCGTCTAT
>probe:Drosophila_2:1623439_at:39:571; Interrogation_Position=808; Antisense; GGCTTCCAACGGTTTTCATTGTACA
>probe:Drosophila_2:1623439_at:336:153; Interrogation_Position=864; Antisense; ACATGACTCCGGCATATGGGCGGTA
>probe:Drosophila_2:1623439_at:65:171; Interrogation_Position=891; Antisense; AAAGAGTTCGCCTCCAGTGTATTGG

Paste this into a BLAST search page for me
GACTACCGGGTGATCTTAAGGCCATAAGTTCGATTATGCCTATTCCGTTGGCCTATTCCGTTGCAAAGCCTATAAGACATGGAGGACTTTGTAACGCACCTCAGCCGCCTGTGTAGCAAGAATCTAGGGACCTATACGATCTGGCTTCGAAGTCGCGAATTGCAAGTCTTAGGAATCGATGCCCACTTGGAGTCCGAAGAACTTGCCACGGGAACCAATGCTGATGATAAGGCCCGGACTTAAGCCAAATATCAGGAAGTCATCTCACCGTCTATGGCTTCCAACGGTTTTCATTGTACAACATGACTCCGGCATATGGGCGGTAAAAGAGTTCGCCTCCAGTGTATTGG

Full Affymetrix probeset data:

Annotations for 1623439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720