FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623440_at:

>probe:Drosophila_2:1623440_at:453:637; Interrogation_Position=104; Antisense; TCGAGATTGCTGAGGACGTGCCCAA
>probe:Drosophila_2:1623440_at:72:517; Interrogation_Position=15; Antisense; GTGTCCAGTGACCAATTGCCAGGCG
>probe:Drosophila_2:1623440_at:166:647; Interrogation_Position=185; Antisense; TCATCGCCTATGAGGGAGCCCCAAA
>probe:Drosophila_2:1623440_at:694:255; Interrogation_Position=206; Antisense; CAAAGCCGGGTCTTAGTTGTGCTGT
>probe:Drosophila_2:1623440_at:420:95; Interrogation_Position=220; Antisense; AGTTGTGCTGTTACTTCGGATCTGC
>probe:Drosophila_2:1623440_at:109:715; Interrogation_Position=234; Antisense; TTCGGATCTGCAGATTGTCCACCAT
>probe:Drosophila_2:1623440_at:521:625; Interrogation_Position=260; Antisense; TGCCCATTATCCTGATGCTCTATGT
>probe:Drosophila_2:1623440_at:240:681; Interrogation_Position=280; Antisense; TATGTGAGCCCTCCTATTCTGAACA
>probe:Drosophila_2:1623440_at:357:579; Interrogation_Position=312; Antisense; GGCCTACATCTTATACCTGGTGAGT
>probe:Drosophila_2:1623440_at:187:231; Interrogation_Position=364; Antisense; AATGTAACACTCCTCGACGGATTCC
>probe:Drosophila_2:1623440_at:162:351; Interrogation_Position=39; Antisense; GCAGATGTCGCCACTCGAGATGCTG
>probe:Drosophila_2:1623440_at:578:571; Interrogation_Position=461; Antisense; GGCTGTATTGCAACACGGACTACCT
>probe:Drosophila_2:1623440_at:272:421; Interrogation_Position=529; Antisense; GAGCAGCGTAGGATCTTCGTCAAGA
>probe:Drosophila_2:1623440_at:250:425; Interrogation_Position=55; Antisense; GAGATGCTGGCCCATCTGATGATGC

Paste this into a BLAST search page for me
TCGAGATTGCTGAGGACGTGCCCAAGTGTCCAGTGACCAATTGCCAGGCGTCATCGCCTATGAGGGAGCCCCAAACAAAGCCGGGTCTTAGTTGTGCTGTAGTTGTGCTGTTACTTCGGATCTGCTTCGGATCTGCAGATTGTCCACCATTGCCCATTATCCTGATGCTCTATGTTATGTGAGCCCTCCTATTCTGAACAGGCCTACATCTTATACCTGGTGAGTAATGTAACACTCCTCGACGGATTCCGCAGATGTCGCCACTCGAGATGCTGGGCTGTATTGCAACACGGACTACCTGAGCAGCGTAGGATCTTCGTCAAGAGAGATGCTGGCCCATCTGATGATGC

Full Affymetrix probeset data:

Annotations for 1623440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720