Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623441_at:

>probe:Drosophila_2:1623441_at:697:443; Interrogation_Position=5305; Antisense; GATGATCTCCTAACCGAGCAGTGGA
>probe:Drosophila_2:1623441_at:70:295; Interrogation_Position=5319; Antisense; CGAGCAGTGGACCTGGTTCAACCAA
>probe:Drosophila_2:1623441_at:657:539; Interrogation_Position=5333; Antisense; GGTTCAACCAAGTCTGTCGTGCCAG
>probe:Drosophila_2:1623441_at:288:501; Interrogation_Position=5348; Antisense; GTCGTGCCAGGTGATTCTGATTCAA
>probe:Drosophila_2:1623441_at:200:513; Interrogation_Position=5358; Antisense; GTGATTCTGATTCAATCGGGCAGGC
>probe:Drosophila_2:1623441_at:599:555; Interrogation_Position=5388; Antisense; GGACGCGAATCCATTTGCAAAATAT
>probe:Drosophila_2:1623441_at:730:701; Interrogation_Position=5415; Antisense; TTAGCATCAGGCCATCAGGTCTTAA
>probe:Drosophila_2:1623441_at:459:577; Interrogation_Position=5424; Antisense; GGCCATCAGGTCTTAAACCCATTGA
>probe:Drosophila_2:1623441_at:613:133; Interrogation_Position=5440; Antisense; ACCCATTGACTTTGTACATACTCCC
>probe:Drosophila_2:1623441_at:169:601; Interrogation_Position=5452; Antisense; TGTACATACTCCCAAGATCACTTAT
>probe:Drosophila_2:1623441_at:406:487; Interrogation_Position=5622; Antisense; GTAGCATATTAATAACTCCCAACGT
>probe:Drosophila_2:1623441_at:289:145; Interrogation_Position=5636; Antisense; ACTCCCAACGTCATGGATAGTTTGT
>probe:Drosophila_2:1623441_at:279:487; Interrogation_Position=5689; Antisense; GTAGCACTATGATTGTTCTAACAAC
>probe:Drosophila_2:1623441_at:324:721; Interrogation_Position=5783; Antisense; TTGAATGCCTAGACCTAAGCTTTTT

Paste this into a BLAST search page for me
GATGATCTCCTAACCGAGCAGTGGACGAGCAGTGGACCTGGTTCAACCAAGGTTCAACCAAGTCTGTCGTGCCAGGTCGTGCCAGGTGATTCTGATTCAAGTGATTCTGATTCAATCGGGCAGGCGGACGCGAATCCATTTGCAAAATATTTAGCATCAGGCCATCAGGTCTTAAGGCCATCAGGTCTTAAACCCATTGAACCCATTGACTTTGTACATACTCCCTGTACATACTCCCAAGATCACTTATGTAGCATATTAATAACTCCCAACGTACTCCCAACGTCATGGATAGTTTGTGTAGCACTATGATTGTTCTAACAACTTGAATGCCTAGACCTAAGCTTTTT

Full Affymetrix probeset data:

Annotations for 1623441_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime