FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623442_at:

>probe:Drosophila_2:1623442_at:145:373; Interrogation_Position=113; Antisense; GAAGGGATGGCCTGTCGCCAGATAT
>probe:Drosophila_2:1623442_at:719:457; Interrogation_Position=133; Antisense; GATATAGTTGGTCCCTGGACGGCCA
>probe:Drosophila_2:1623442_at:176:347; Interrogation_Position=176; Antisense; GCATCGTTGGCGTGGGAACCCTGAT
>probe:Drosophila_2:1623442_at:194:381; Interrogation_Position=191; Antisense; GAACCCTGATCCACGAGCGATTTAT
>probe:Drosophila_2:1623442_at:565:25; Interrogation_Position=310; Antisense; ATAGTCGCTGCATTCTTCAGTAACG
>probe:Drosophila_2:1623442_at:553:647; Interrogation_Position=326; Antisense; TCAGTAACGCCAACTTTAATCCGGA
>probe:Drosophila_2:1623442_at:287:623; Interrogation_Position=36; Antisense; TGCGGTGCTCACAAGTCTACTGATT
>probe:Drosophila_2:1623442_at:133:391; Interrogation_Position=378; Antisense; GAAACTGCTGCGAACCGTAGTATAC
>probe:Drosophila_2:1623442_at:659:245; Interrogation_Position=414; Antisense; AATTCCGGTCTGCATTCTTATGGAC
>probe:Drosophila_2:1623442_at:501:679; Interrogation_Position=432; Antisense; TATGGACTCACGGATGCAGACGTTC
>probe:Drosophila_2:1623442_at:249:165; Interrogation_Position=505; Antisense; AAATCACCCTATGCTGAGGTCCAAA
>probe:Drosophila_2:1623442_at:582:195; Interrogation_Position=529; Antisense; AACTGTGATCCGAATGCCGCAGGCA
>probe:Drosophila_2:1623442_at:703:597; Interrogation_Position=581; Antisense; TGTGCCGGCCACAAAGATCTGGACT
>probe:Drosophila_2:1623442_at:534:637; Interrogation_Position=67; Antisense; TCGGGAACAGGATCGGCGCAATTCT

Paste this into a BLAST search page for me
GAAGGGATGGCCTGTCGCCAGATATGATATAGTTGGTCCCTGGACGGCCAGCATCGTTGGCGTGGGAACCCTGATGAACCCTGATCCACGAGCGATTTATATAGTCGCTGCATTCTTCAGTAACGTCAGTAACGCCAACTTTAATCCGGATGCGGTGCTCACAAGTCTACTGATTGAAACTGCTGCGAACCGTAGTATACAATTCCGGTCTGCATTCTTATGGACTATGGACTCACGGATGCAGACGTTCAAATCACCCTATGCTGAGGTCCAAAAACTGTGATCCGAATGCCGCAGGCATGTGCCGGCCACAAAGATCTGGACTTCGGGAACAGGATCGGCGCAATTCT

Full Affymetrix probeset data:

Annotations for 1623442_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720