FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623445_at:

>probe:Drosophila_2:1623445_at:384:143; Interrogation_Position=136; Antisense; ACTGCCGCCAGTAGCCAAGTCGTGG
>probe:Drosophila_2:1623445_at:321:219; Interrogation_Position=152; Antisense; AAGTCGTGGCCAGGACCTTCAACGG
>probe:Drosophila_2:1623445_at:36:337; Interrogation_Position=184; Antisense; GCTGCTCCAGTGATTGCCCAAGTTC
>probe:Drosophila_2:1623445_at:294:163; Interrogation_Position=19; Antisense; AAATACGCCGTTGTCATTTGCGCCC
>probe:Drosophila_2:1623445_at:352:7; Interrogation_Position=196; Antisense; ATTGCCCAAGTTCCGGTGGCTCCTG
>probe:Drosophila_2:1623445_at:724:617; Interrogation_Position=219; Antisense; TGCTCCAGTTTTGCGGACCGTAGCA
>probe:Drosophila_2:1623445_at:410:577; Interrogation_Position=336; Antisense; GGCCGCTCCAATCCTGAACAGAGTG
>probe:Drosophila_2:1623445_at:650:19; Interrogation_Position=34; Antisense; ATTTGCGCCCTGATCGCCTGTGTGG
>probe:Drosophila_2:1623445_at:436:189; Interrogation_Position=352; Antisense; AACAGAGTGGCTCCATTTGCTGCTC
>probe:Drosophila_2:1623445_at:179:51; Interrogation_Position=416; Antisense; ATGCTGCGCCCGTTTTGGCCAAATA
>probe:Drosophila_2:1623445_at:608:691; Interrogation_Position=429; Antisense; TTTGGCCAAATACGCTGCTCCACTG
>probe:Drosophila_2:1623445_at:673:681; Interrogation_Position=457; Antisense; TATGCCCCAGCACCTTTGAACTATG
>probe:Drosophila_2:1623445_at:639:571; Interrogation_Position=57; Antisense; GGCTGCCAAGCCAGGATTGCTGCAC
>probe:Drosophila_2:1623445_at:299:79; Interrogation_Position=69; Antisense; AGGATTGCTGCACACTCCTCTGGCA

Paste this into a BLAST search page for me
ACTGCCGCCAGTAGCCAAGTCGTGGAAGTCGTGGCCAGGACCTTCAACGGGCTGCTCCAGTGATTGCCCAAGTTCAAATACGCCGTTGTCATTTGCGCCCATTGCCCAAGTTCCGGTGGCTCCTGTGCTCCAGTTTTGCGGACCGTAGCAGGCCGCTCCAATCCTGAACAGAGTGATTTGCGCCCTGATCGCCTGTGTGGAACAGAGTGGCTCCATTTGCTGCTCATGCTGCGCCCGTTTTGGCCAAATATTTGGCCAAATACGCTGCTCCACTGTATGCCCCAGCACCTTTGAACTATGGGCTGCCAAGCCAGGATTGCTGCACAGGATTGCTGCACACTCCTCTGGCA

Full Affymetrix probeset data:

Annotations for 1623445_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720