Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623447_a_at:

>probe:Drosophila_2:1623447_a_at:121:141; Interrogation_Position=587; Antisense; ACTATAACGGCCTTGGGTCTGACCA
>probe:Drosophila_2:1623447_a_at:559:715; Interrogation_Position=621; Antisense; TTCGTGAGCGTGGAATCTTCGGTTT
>probe:Drosophila_2:1623447_a_at:549:699; Interrogation_Position=643; Antisense; TTTATACAAGGGTGTGGGCGCCACT
>probe:Drosophila_2:1623447_a_at:303:669; Interrogation_Position=682; Antisense; TACGTTCTCGATGGTGTACTTTCCG
>probe:Drosophila_2:1623447_a_at:321:489; Interrogation_Position=697; Antisense; GTACTTTCCGCTAATGGCCTGGATA
>probe:Drosophila_2:1623447_a_at:440:523; Interrogation_Position=731; Antisense; GGGCCACGCAAGTCAGATGGTTCTG
>probe:Drosophila_2:1623447_a_at:608:205; Interrogation_Position=759; Antisense; AAGCGGTCTTCTACTGGTCTCTGAT
>probe:Drosophila_2:1623447_a_at:252:27; Interrogation_Position=782; Antisense; ATAGCTGGACTCTTGTCTGGCATGA
>probe:Drosophila_2:1623447_a_at:82:569; Interrogation_Position=800; Antisense; GGCATGACTTCTGCCTTTATGGTCA
>probe:Drosophila_2:1623447_a_at:360:589; Interrogation_Position=819; Antisense; TGGTCACCCCTTTTGATGTGGTCAA
>probe:Drosophila_2:1623447_a_at:428:537; Interrogation_Position=838; Antisense; GGTCAAGACTCGACTGCAGGCCGAT
>probe:Drosophila_2:1623447_a_at:595:659; Interrogation_Position=936; Antisense; TTAAGGGCGGTCTATGTCGGATAAT
>probe:Drosophila_2:1623447_a_at:132:501; Interrogation_Position=951; Antisense; GTCGGATAATGGTGCTAGCTCCACT
>probe:Drosophila_2:1623447_a_at:314:119; Interrogation_Position=967; Antisense; AGCTCCACTATTTGGTATCGCGCAA

Paste this into a BLAST search page for me
ACTATAACGGCCTTGGGTCTGACCATTCGTGAGCGTGGAATCTTCGGTTTTTTATACAAGGGTGTGGGCGCCACTTACGTTCTCGATGGTGTACTTTCCGGTACTTTCCGCTAATGGCCTGGATAGGGCCACGCAAGTCAGATGGTTCTGAAGCGGTCTTCTACTGGTCTCTGATATAGCTGGACTCTTGTCTGGCATGAGGCATGACTTCTGCCTTTATGGTCATGGTCACCCCTTTTGATGTGGTCAAGGTCAAGACTCGACTGCAGGCCGATTTAAGGGCGGTCTATGTCGGATAATGTCGGATAATGGTGCTAGCTCCACTAGCTCCACTATTTGGTATCGCGCAA

Full Affymetrix probeset data:

Annotations for 1623447_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime