Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623448_at:

>probe:Drosophila_2:1623448_at:108:451; Interrogation_Position=1038; Antisense; GATCTTTTCGCAGGGTTGGCGTGTT
>probe:Drosophila_2:1623448_at:399:317; Interrogation_Position=1100; Antisense; GCCTGCGACCCAACGACATGATTAA
>probe:Drosophila_2:1623448_at:443:153; Interrogation_Position=1115; Antisense; ACATGATTAAGGTCACTCGCTTCCG
>probe:Drosophila_2:1623448_at:523:203; Interrogation_Position=1141; Antisense; AACCACTGGCTGTTCGGCGAGCGAG
>probe:Drosophila_2:1623448_at:667:325; Interrogation_Position=1157; Antisense; GCGAGCGAGTGCTTTCCGAGCAAGA
>probe:Drosophila_2:1623448_at:611:303; Interrogation_Position=1172; Antisense; CCGAGCAAGAGCTAGCTGGCGTCAA
>probe:Drosophila_2:1623448_at:99:359; Interrogation_Position=1208; Antisense; GCAAGGGTCCCATTCGTGGCTGGTT
>probe:Drosophila_2:1623448_at:277:293; Interrogation_Position=1248; Antisense; CGTTGAGGTCATTGAGGCGGTCCAT
>probe:Drosophila_2:1623448_at:561:183; Interrogation_Position=1373; Antisense; AAAAGTACATGTAGCCCGGATCGGG
>probe:Drosophila_2:1623448_at:636:427; Interrogation_Position=1400; Antisense; GAGATCAATCGATGGCATTCTGTGC
>probe:Drosophila_2:1623448_at:46:717; Interrogation_Position=1417; Antisense; TTCTGTGCCACATTCGGCTTGTATA
>probe:Drosophila_2:1623448_at:412:677; Interrogation_Position=1448; Antisense; TAGATTCCGCTTGGAGACTCGACTG
>probe:Drosophila_2:1623448_at:385:405; Interrogation_Position=1463; Antisense; GACTCGACTGTTTAACGCTTAGCCA
>probe:Drosophila_2:1623448_at:394:497; Interrogation_Position=1492; Antisense; GTCATCCCGTTTACTCTGTTAACAA

Paste this into a BLAST search page for me
GATCTTTTCGCAGGGTTGGCGTGTTGCCTGCGACCCAACGACATGATTAAACATGATTAAGGTCACTCGCTTCCGAACCACTGGCTGTTCGGCGAGCGAGGCGAGCGAGTGCTTTCCGAGCAAGACCGAGCAAGAGCTAGCTGGCGTCAAGCAAGGGTCCCATTCGTGGCTGGTTCGTTGAGGTCATTGAGGCGGTCCATAAAAGTACATGTAGCCCGGATCGGGGAGATCAATCGATGGCATTCTGTGCTTCTGTGCCACATTCGGCTTGTATATAGATTCCGCTTGGAGACTCGACTGGACTCGACTGTTTAACGCTTAGCCAGTCATCCCGTTTACTCTGTTAACAA

Full Affymetrix probeset data:

Annotations for 1623448_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime