FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623449_at:

>probe:Drosophila_2:1623449_at:192:53; Interrogation_Position=1003; Antisense; ATGCTCTGCTAACCCACAAGTGGTA
>probe:Drosophila_2:1623449_at:526:209; Interrogation_Position=1053; Antisense; AAGAACCGACGTGCTATCATTCCGT
>probe:Drosophila_2:1623449_at:698:469; Interrogation_Position=1076; Antisense; GTTCCTGCTCTGAGTCCGAAGACTG
>probe:Drosophila_2:1623449_at:184:165; Interrogation_Position=604; Antisense; AAATCAATCTGTCGCACTATGCCGT
>probe:Drosophila_2:1623449_at:60:63; Interrogation_Position=634; Antisense; ATGTGCACTACTTTGGAGCCGTTAT
>probe:Drosophila_2:1623449_at:498:25; Interrogation_Position=657; Antisense; ATAGCTTTACTATCCAATACCTCCG
>probe:Drosophila_2:1623449_at:132:205; Interrogation_Position=699; Antisense; AAGCCCATGGAGTTCAGCCTCGACA
>probe:Drosophila_2:1623449_at:108:561; Interrogation_Position=845; Antisense; GGAAAAGCACCTTCTGCCCAAGGGT
>probe:Drosophila_2:1623449_at:647:251; Interrogation_Position=863; Antisense; CAAGGGTGGGCTTTTCAATCTGCTT
>probe:Drosophila_2:1623449_at:662:297; Interrogation_Position=895; Antisense; CGCACATGTTCCTCGAGGTGGTCAT
>probe:Drosophila_2:1623449_at:415:81; Interrogation_Position=910; Antisense; AGGTGGTCATGTACTTCTGCATCGC
>probe:Drosophila_2:1623449_at:1:317; Interrogation_Position=933; Antisense; GCCGATCTCTACATGCCAGTTAGGA
>probe:Drosophila_2:1623449_at:606:465; Interrogation_Position=964; Antisense; GATTGATCTTCCTCTGGGTGGCCAG
>probe:Drosophila_2:1623449_at:108:533; Interrogation_Position=979; Antisense; GGGTGGCCAGCAATCAAACGATCAA

Paste this into a BLAST search page for me
ATGCTCTGCTAACCCACAAGTGGTAAAGAACCGACGTGCTATCATTCCGTGTTCCTGCTCTGAGTCCGAAGACTGAAATCAATCTGTCGCACTATGCCGTATGTGCACTACTTTGGAGCCGTTATATAGCTTTACTATCCAATACCTCCGAAGCCCATGGAGTTCAGCCTCGACAGGAAAAGCACCTTCTGCCCAAGGGTCAAGGGTGGGCTTTTCAATCTGCTTCGCACATGTTCCTCGAGGTGGTCATAGGTGGTCATGTACTTCTGCATCGCGCCGATCTCTACATGCCAGTTAGGAGATTGATCTTCCTCTGGGTGGCCAGGGGTGGCCAGCAATCAAACGATCAA

Full Affymetrix probeset data:

Annotations for 1623449_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720