FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623450_at:

>probe:Drosophila_2:1623450_at:172:101; Interrogation_Position=1004; Antisense; AGAGGACCATTAATCGCTTCCTGCT
>probe:Drosophila_2:1623450_at:489:121; Interrogation_Position=1037; Antisense; AGCGGAGTATTGACCAGCCCCTGGA
>probe:Drosophila_2:1623450_at:156:553; Interrogation_Position=1069; Antisense; GGAATCGTTACGCTGGACACTCGCT
>probe:Drosophila_2:1623450_at:621:605; Interrogation_Position=1118; Antisense; TGATGGCCATTGTCATTTTCCTCAT
>probe:Drosophila_2:1623450_at:282:215; Interrogation_Position=622; Antisense; AAGTTGGATGCCTGCTACGAGTCCG
>probe:Drosophila_2:1623450_at:659:313; Interrogation_Position=646; Antisense; GCCTTTGCTGTCCTAGTAGATGCGG
>probe:Drosophila_2:1623450_at:232:361; Interrogation_Position=713; Antisense; GCAATCTTATCGAGCAGGTCCACAG
>probe:Drosophila_2:1623450_at:228:79; Interrogation_Position=728; Antisense; AGGTCCACAGCCAGTTTCTACTGAG
>probe:Drosophila_2:1623450_at:403:459; Interrogation_Position=752; Antisense; GATTTGGTCTCTATCTGGTGTTAAA
>probe:Drosophila_2:1623450_at:202:591; Interrogation_Position=767; Antisense; TGGTGTTAAACCTGCTCAATTCCTT
>probe:Drosophila_2:1623450_at:492:653; Interrogation_Position=782; Antisense; TCAATTCCTTGGTCAGCATCTGTGT
>probe:Drosophila_2:1623450_at:641:53; Interrogation_Position=892; Antisense; ATGCATGGCGGTCGTATCTGGTTCA
>probe:Drosophila_2:1623450_at:564:285; Interrogation_Position=909; Antisense; CTGGTTCATCCTGTCGGTCAACGAA
>probe:Drosophila_2:1623450_at:169:107; Interrogation_Position=947; Antisense; AGAAATGTAACCTTTGCCAGCTGCT

Paste this into a BLAST search page for me
AGAGGACCATTAATCGCTTCCTGCTAGCGGAGTATTGACCAGCCCCTGGAGGAATCGTTACGCTGGACACTCGCTTGATGGCCATTGTCATTTTCCTCATAAGTTGGATGCCTGCTACGAGTCCGGCCTTTGCTGTCCTAGTAGATGCGGGCAATCTTATCGAGCAGGTCCACAGAGGTCCACAGCCAGTTTCTACTGAGGATTTGGTCTCTATCTGGTGTTAAATGGTGTTAAACCTGCTCAATTCCTTTCAATTCCTTGGTCAGCATCTGTGTATGCATGGCGGTCGTATCTGGTTCACTGGTTCATCCTGTCGGTCAACGAAAGAAATGTAACCTTTGCCAGCTGCT

Full Affymetrix probeset data:

Annotations for 1623450_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720