FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623451_at:

>probe:Drosophila_2:1623451_at:411:183; Interrogation_Position=509; Antisense; AAAATGGCCCAGTTTGTGACCCACA
>probe:Drosophila_2:1623451_at:282:49; Interrogation_Position=533; Antisense; ATCCAGCCAACGCTGATGGAGGCGT
>probe:Drosophila_2:1623451_at:666:63; Interrogation_Position=548; Antisense; ATGGAGGCGTCCCAAGGTCATGTTC
>probe:Drosophila_2:1623451_at:570:269; Interrogation_Position=587; Antisense; CATCAGGTGGGTGTGCAGCACTCGT
>probe:Drosophila_2:1623451_at:727:589; Interrogation_Position=682; Antisense; TGGTCATCATACCAGCAGCGGTGGT
>probe:Drosophila_2:1623451_at:624:419; Interrogation_Position=717; Antisense; GAGCAGGTGGCCATTCACAGAAGCA
>probe:Drosophila_2:1623451_at:496:209; Interrogation_Position=737; Antisense; AAGCAGGCAGCGCATCATAGCACCA
>probe:Drosophila_2:1623451_at:79:435; Interrogation_Position=805; Antisense; GAGGATCCATTCACCGCCAACGGAA
>probe:Drosophila_2:1623451_at:102:187; Interrogation_Position=828; Antisense; AACACCATCCGGATCATGTCGGTCA
>probe:Drosophila_2:1623451_at:601:61; Interrogation_Position=843; Antisense; ATGTCGGTCACTACGAGTACTTCCA
>probe:Drosophila_2:1623451_at:531:489; Interrogation_Position=859; Antisense; GTACTTCCAGCATCAGCACGAGCAG
>probe:Drosophila_2:1623451_at:383:355; Interrogation_Position=874; Antisense; GCACGAGCAGATCTTCCACCATGAA
>probe:Drosophila_2:1623451_at:605:177; Interrogation_Position=904; Antisense; AAACGGTGGTGCCAGCCACAAGCAA
>probe:Drosophila_2:1623451_at:715:99; Interrogation_Position=978; Antisense; AGAGTGCGGTGAGTTGTCCTGCCTA

Paste this into a BLAST search page for me
AAAATGGCCCAGTTTGTGACCCACAATCCAGCCAACGCTGATGGAGGCGTATGGAGGCGTCCCAAGGTCATGTTCCATCAGGTGGGTGTGCAGCACTCGTTGGTCATCATACCAGCAGCGGTGGTGAGCAGGTGGCCATTCACAGAAGCAAAGCAGGCAGCGCATCATAGCACCAGAGGATCCATTCACCGCCAACGGAAAACACCATCCGGATCATGTCGGTCAATGTCGGTCACTACGAGTACTTCCAGTACTTCCAGCATCAGCACGAGCAGGCACGAGCAGATCTTCCACCATGAAAAACGGTGGTGCCAGCCACAAGCAAAGAGTGCGGTGAGTTGTCCTGCCTA

Full Affymetrix probeset data:

Annotations for 1623451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720