FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623452_at:

>probe:Drosophila_2:1623452_at:674:617; Interrogation_Position=108; Antisense; TGCAGCTGCTCCTGCCGGCGTGGTC
>probe:Drosophila_2:1623452_at:414:589; Interrogation_Position=128; Antisense; TGGTCACCGCTACCAGTTCGCAGTA
>probe:Drosophila_2:1623452_at:581:59; Interrogation_Position=13; Antisense; ATGTTCAAGCTGTCTGCCCTCGTTG
>probe:Drosophila_2:1623452_at:659:131; Interrogation_Position=133; Antisense; ACCGCTACCAGTTCGCAGTACGTGG
>probe:Drosophila_2:1623452_at:697:93; Interrogation_Position=142; Antisense; AGTTCGCAGTACGTGGCCCGCAACT
>probe:Drosophila_2:1623452_at:373:521; Interrogation_Position=154; Antisense; GTGGCCCGCAACTTCAACGGTGTGG
>probe:Drosophila_2:1623452_at:242:255; Interrogation_Position=162; Antisense; CAACTTCAACGGTGTGGCTGCTGCT
>probe:Drosophila_2:1623452_at:8:621; Interrogation_Position=183; Antisense; TGCTCCAGTTGTTGCCGCTGCCTAC
>probe:Drosophila_2:1623452_at:28:95; Interrogation_Position=270; Antisense; AGTTGCCGCTGCCTACTCTGCTTAT
>probe:Drosophila_2:1623452_at:655:667; Interrogation_Position=283; Antisense; TACTCTGCTTATCCGTATGCCGCCT
>probe:Drosophila_2:1623452_at:187:301; Interrogation_Position=29; Antisense; CCCTCGTTGTCCTGTGCGCTCTGGT
>probe:Drosophila_2:1623452_at:265:709; Interrogation_Position=312; Antisense; TTACAGCGCTGCATACACCACTGTT
>probe:Drosophila_2:1623452_at:141:299; Interrogation_Position=318; Antisense; CGCTGCATACACCACTGTTTTGTAA
>probe:Drosophila_2:1623452_at:226:577; Interrogation_Position=90; Antisense; GGCCGCCGCTCCAGTGGTTGCAGCT

Paste this into a BLAST search page for me
TGCAGCTGCTCCTGCCGGCGTGGTCTGGTCACCGCTACCAGTTCGCAGTAATGTTCAAGCTGTCTGCCCTCGTTGACCGCTACCAGTTCGCAGTACGTGGAGTTCGCAGTACGTGGCCCGCAACTGTGGCCCGCAACTTCAACGGTGTGGCAACTTCAACGGTGTGGCTGCTGCTTGCTCCAGTTGTTGCCGCTGCCTACAGTTGCCGCTGCCTACTCTGCTTATTACTCTGCTTATCCGTATGCCGCCTCCCTCGTTGTCCTGTGCGCTCTGGTTTACAGCGCTGCATACACCACTGTTCGCTGCATACACCACTGTTTTGTAAGGCCGCCGCTCCAGTGGTTGCAGCT

Full Affymetrix probeset data:

Annotations for 1623452_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720