FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623453_at:

>probe:Drosophila_2:1623453_at:160:69; Interrogation_Position=344; Antisense; AGGCCATCGAACGTAGCGTCGCGGA
>probe:Drosophila_2:1623453_at:454:137; Interrogation_Position=392; Antisense; ACGACCTGCTGGTGGCGTTCAGCAA
>probe:Drosophila_2:1623453_at:302:575; Interrogation_Position=405; Antisense; GGCGTTCAGCAATCTGGGATTCGAC
>probe:Drosophila_2:1623453_at:541:463; Interrogation_Position=422; Antisense; GATTCGACAATTACGTGGAACCACT
>probe:Drosophila_2:1623453_at:136:381; Interrogation_Position=439; Antisense; GAACCACTGTCCATTTACCTGCAAA
>probe:Drosophila_2:1623453_at:238:131; Interrogation_Position=455; Antisense; ACCTGCAAAAGTACCGAGAGTCGAA
>probe:Drosophila_2:1623453_at:516:41; Interrogation_Position=483; Antisense; ATCGGATCGTAATCTCTTTCTGGAC
>probe:Drosophila_2:1623453_at:572:411; Interrogation_Position=505; Antisense; GACGCCAGTTATCCGCACAACGAAG
>probe:Drosophila_2:1623453_at:541:375; Interrogation_Position=526; Antisense; GAAGATGGGTCCTCCGCAAACGATG
>probe:Drosophila_2:1623453_at:171:477; Interrogation_Position=639; Antisense; GTTTAATCCTAACAGTACACCTTGA
>probe:Drosophila_2:1623453_at:212:663; Interrogation_Position=776; Antisense; TAAATCCATTTTTACTCTCCCGATA
>probe:Drosophila_2:1623453_at:556:687; Interrogation_Position=816; Antisense; TATTTAGGTCTTGGTACTGGTAGCA
>probe:Drosophila_2:1623453_at:57:271; Interrogation_Position=843; Antisense; CATGAATTTATGTATCGCGGGCCCA
>probe:Drosophila_2:1623453_at:154:681; Interrogation_Position=855; Antisense; TATCGCGGGCCCATTAAGCCAAATT

Paste this into a BLAST search page for me
AGGCCATCGAACGTAGCGTCGCGGAACGACCTGCTGGTGGCGTTCAGCAAGGCGTTCAGCAATCTGGGATTCGACGATTCGACAATTACGTGGAACCACTGAACCACTGTCCATTTACCTGCAAAACCTGCAAAAGTACCGAGAGTCGAAATCGGATCGTAATCTCTTTCTGGACGACGCCAGTTATCCGCACAACGAAGGAAGATGGGTCCTCCGCAAACGATGGTTTAATCCTAACAGTACACCTTGATAAATCCATTTTTACTCTCCCGATATATTTAGGTCTTGGTACTGGTAGCACATGAATTTATGTATCGCGGGCCCATATCGCGGGCCCATTAAGCCAAATT

Full Affymetrix probeset data:

Annotations for 1623453_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720