FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623456_at:

>probe:Drosophila_2:1623456_at:730:169; Interrogation_Position=235; Antisense; AAAGGGTCATCATCTGTGAGCAGCC
>probe:Drosophila_2:1623456_at:320:623; Interrogation_Position=310; Antisense; TGCGGCATTTGCTTCGAGACGATCA
>probe:Drosophila_2:1623456_at:467:551; Interrogation_Position=349; Antisense; GGAGATAAGCGTTTCGGCATCCTGC
>probe:Drosophila_2:1623456_at:90:515; Interrogation_Position=388; Antisense; GTGTTCTGCTTCCAGTGCATTTGCA
>probe:Drosophila_2:1623456_at:517:49; Interrogation_Position=422; Antisense; ATGCCACACAGTATGCCTATCAAGT
>probe:Drosophila_2:1623456_at:610:293; Interrogation_Position=462; Antisense; CGAATGTCGCGTGTGGTCTAACTTT
>probe:Drosophila_2:1623456_at:78:499; Interrogation_Position=477; Antisense; GTCTAACTTTGTATGTCCCAGTGCA
>probe:Drosophila_2:1623456_at:682:575; Interrogation_Position=522; Antisense; GGCGAAGGACCAGCTCATCAATGAT
>probe:Drosophila_2:1623456_at:631:223; Interrogation_Position=596; Antisense; AAGGCGTGTGCCTCTTTGGCAACAA
>probe:Drosophila_2:1623456_at:537:699; Interrogation_Position=625; Antisense; TTTTACAAGCACTCTATACCCAACG
>probe:Drosophila_2:1623456_at:290:83; Interrogation_Position=687; Antisense; AGGGCTACCGATTCCATCAGATTTT
>probe:Drosophila_2:1623456_at:56:685; Interrogation_Position=732; Antisense; TATTTTGGTTCCTTTCCCGAATATG
>probe:Drosophila_2:1623456_at:149:461; Interrogation_Position=766; Antisense; GATTTCAGCAATTCCGACGACTACG
>probe:Drosophila_2:1623456_at:637:407; Interrogation_Position=781; Antisense; GACGACTACGATTTCTCGGACGTAA

Paste this into a BLAST search page for me
AAAGGGTCATCATCTGTGAGCAGCCTGCGGCATTTGCTTCGAGACGATCAGGAGATAAGCGTTTCGGCATCCTGCGTGTTCTGCTTCCAGTGCATTTGCAATGCCACACAGTATGCCTATCAAGTCGAATGTCGCGTGTGGTCTAACTTTGTCTAACTTTGTATGTCCCAGTGCAGGCGAAGGACCAGCTCATCAATGATAAGGCGTGTGCCTCTTTGGCAACAATTTTACAAGCACTCTATACCCAACGAGGGCTACCGATTCCATCAGATTTTTATTTTGGTTCCTTTCCCGAATATGGATTTCAGCAATTCCGACGACTACGGACGACTACGATTTCTCGGACGTAA

Full Affymetrix probeset data:

Annotations for 1623456_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720