Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623458_at:

>probe:Drosophila_2:1623458_at:18:589; Interrogation_Position=1009; Antisense; TGGAGGACGTCTATCCTACACTGTC
>probe:Drosophila_2:1623458_at:728:597; Interrogation_Position=1030; Antisense; TGTCCAACGGCTACAGACTGATCAA
>probe:Drosophila_2:1623458_at:184:613; Interrogation_Position=1069; Antisense; TGAAACGTCTCTTCAATGAGCACAT
>probe:Drosophila_2:1623458_at:149:609; Interrogation_Position=1085; Antisense; TGAGCACATCGAACGCAACTTCCAG
>probe:Drosophila_2:1623458_at:716:621; Interrogation_Position=1115; Antisense; TGCTGAGGATCGACCTGGCGGATTT
>probe:Drosophila_2:1623458_at:671:261; Interrogation_Position=1158; Antisense; CAGCCCCTGCTACCGGAAGAGATTG
>probe:Drosophila_2:1623458_at:427:465; Interrogation_Position=1264; Antisense; GATTGTTAAAACGTTCTTCTGTTCA
>probe:Drosophila_2:1623458_at:416:397; Interrogation_Position=1302; Antisense; GACAACAATGTTGTGTACCCTCCGC
>probe:Drosophila_2:1623458_at:508:129; Interrogation_Position=1328; Antisense; ACCTTCTGTTTGGTGCTTGGTGTAA
>probe:Drosophila_2:1623458_at:437:351; Interrogation_Position=1404; Antisense; GCAGAGCGTGTGTGTATGTCATTTA
>probe:Drosophila_2:1623458_at:241:101; Interrogation_Position=1448; Antisense; AGAGCTCATTTTCCATACGAGATGT
>probe:Drosophila_2:1623458_at:531:443; Interrogation_Position=1500; Antisense; GATGAATCCACGACAGATTGAACCT
>probe:Drosophila_2:1623458_at:687:463; Interrogation_Position=1515; Antisense; GATTGAACCTACACTGCACATGTGA
>probe:Drosophila_2:1623458_at:333:729; Interrogation_Position=988; Antisense; TTGGCCACATCTACTACGTGCTGGA

Paste this into a BLAST search page for me
TGGAGGACGTCTATCCTACACTGTCTGTCCAACGGCTACAGACTGATCAATGAAACGTCTCTTCAATGAGCACATTGAGCACATCGAACGCAACTTCCAGTGCTGAGGATCGACCTGGCGGATTTCAGCCCCTGCTACCGGAAGAGATTGGATTGTTAAAACGTTCTTCTGTTCAGACAACAATGTTGTGTACCCTCCGCACCTTCTGTTTGGTGCTTGGTGTAAGCAGAGCGTGTGTGTATGTCATTTAAGAGCTCATTTTCCATACGAGATGTGATGAATCCACGACAGATTGAACCTGATTGAACCTACACTGCACATGTGATTGGCCACATCTACTACGTGCTGGA

Full Affymetrix probeset data:

Annotations for 1623458_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime