FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623460_at:

>probe:Drosophila_2:1623460_at:401:315; Interrogation_Position=2439; Antisense; GCCTACAATCTGGACCTTAGCATTA
>probe:Drosophila_2:1623460_at:633:659; Interrogation_Position=2521; Antisense; TAACGCACAGTGATGCTCTCGACAT
>probe:Drosophila_2:1623460_at:190:401; Interrogation_Position=2541; Antisense; GACATTGCCTTCAACACCGAATCGG
>probe:Drosophila_2:1623460_at:422:131; Interrogation_Position=2556; Antisense; ACCGAATCGGTGACATCGTACCTAA
>probe:Drosophila_2:1623460_at:179:387; Interrogation_Position=2588; Antisense; GAAAATTCGCACCACCAATTTTGTG
>probe:Drosophila_2:1623460_at:141:341; Interrogation_Position=2612; Antisense; GCTTTACCCGGGAATCGAGGCTATT
>probe:Drosophila_2:1623460_at:159:319; Interrogation_Position=2678; Antisense; GCCGACCACCGATGATGCAGAAGCT
>probe:Drosophila_2:1623460_at:652:53; Interrogation_Position=2692; Antisense; ATGCAGAAGCTCAGCCTCAGGCGTA
>probe:Drosophila_2:1623460_at:517:543; Interrogation_Position=2787; Antisense; GGATATTCTTGCGATCATAGTTCTT
>probe:Drosophila_2:1623460_at:252:425; Interrogation_Position=2832; Antisense; GAGAGTGGGTTCAACCTGCCCAAAT
>probe:Drosophila_2:1623460_at:118:233; Interrogation_Position=2854; Antisense; AATGCATTTCCGGTGTTGGCCAGAA
>probe:Drosophila_2:1623460_at:31:227; Interrogation_Position=2878; Antisense; AAGGCGCCATCCTAGATTGGTACTT
>probe:Drosophila_2:1623460_at:227:3; Interrogation_Position=2936; Antisense; ATTGGACTAGTTGTAAGCAGCTGCT
>probe:Drosophila_2:1623460_at:487:685; Interrogation_Position=2995; Antisense; TATAATGGTTGCTCTACCTGTGCGC

Paste this into a BLAST search page for me
GCCTACAATCTGGACCTTAGCATTATAACGCACAGTGATGCTCTCGACATGACATTGCCTTCAACACCGAATCGGACCGAATCGGTGACATCGTACCTAAGAAAATTCGCACCACCAATTTTGTGGCTTTACCCGGGAATCGAGGCTATTGCCGACCACCGATGATGCAGAAGCTATGCAGAAGCTCAGCCTCAGGCGTAGGATATTCTTGCGATCATAGTTCTTGAGAGTGGGTTCAACCTGCCCAAATAATGCATTTCCGGTGTTGGCCAGAAAAGGCGCCATCCTAGATTGGTACTTATTGGACTAGTTGTAAGCAGCTGCTTATAATGGTTGCTCTACCTGTGCGC

Full Affymetrix probeset data:

Annotations for 1623460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720