FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623462_at:

>probe:Drosophila_2:1623462_at:278:525; Interrogation_Position=128; Antisense; GGGCTTTCTTATCGCCGGAATGGCA
>probe:Drosophila_2:1623462_at:12:57; Interrogation_Position=13; Antisense; ATGAGCTACTACTACTCGTCTGCCT
>probe:Drosophila_2:1623462_at:49:363; Interrogation_Position=150; Antisense; GCAATTCTTGGATGCCGCAGGCGGA
>probe:Drosophila_2:1623462_at:250:197; Interrogation_Position=180; Antisense; AACGGAACTAGGACCCATCATGGAG
>probe:Drosophila_2:1623462_at:200:173; Interrogation_Position=247; Antisense; AACAGCTTCACAGGATCGGACGGTA
>probe:Drosophila_2:1623462_at:60:39; Interrogation_Position=296; Antisense; ATCTCAGTCCCACGGTCCAGAAAAG
>probe:Drosophila_2:1623462_at:135:51; Interrogation_Position=371; Antisense; ATGCGGCTTTCGAGCGCCTAAGGGA
>probe:Drosophila_2:1623462_at:509:657; Interrogation_Position=389; Antisense; TAAGGGAAGTGGTGCCCGCTCCGTC
>probe:Drosophila_2:1623462_at:568:337; Interrogation_Position=406; Antisense; GCTCCGTCCATTGACCAGAAATTGT
>probe:Drosophila_2:1623462_at:520:3; Interrogation_Position=426; Antisense; ATTGTCCAAGTTCGAGACTCTCCAG
>probe:Drosophila_2:1623462_at:679:581; Interrogation_Position=470; Antisense; TGGCGCTGTGCGATCTTCTCAACAA
>probe:Drosophila_2:1623462_at:725:139; Interrogation_Position=500; Antisense; ACGTGGAAGTGGATGCCGCTGCATA
>probe:Drosophila_2:1623462_at:28:465; Interrogation_Position=557; Antisense; GATTGAGCGGAGGATCCTTGTCATA
>probe:Drosophila_2:1623462_at:181:595; Interrogation_Position=65; Antisense; TGGGCAGTCCCAACTACAACTTGAC

Paste this into a BLAST search page for me
GGGCTTTCTTATCGCCGGAATGGCAATGAGCTACTACTACTCGTCTGCCTGCAATTCTTGGATGCCGCAGGCGGAAACGGAACTAGGACCCATCATGGAGAACAGCTTCACAGGATCGGACGGTAATCTCAGTCCCACGGTCCAGAAAAGATGCGGCTTTCGAGCGCCTAAGGGATAAGGGAAGTGGTGCCCGCTCCGTCGCTCCGTCCATTGACCAGAAATTGTATTGTCCAAGTTCGAGACTCTCCAGTGGCGCTGTGCGATCTTCTCAACAAACGTGGAAGTGGATGCCGCTGCATAGATTGAGCGGAGGATCCTTGTCATATGGGCAGTCCCAACTACAACTTGAC

Full Affymetrix probeset data:

Annotations for 1623462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720