FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623464_at:

>probe:Drosophila_2:1623464_at:448:513; Interrogation_Position=124; Antisense; GTGATCTCCTGCTCTCTGGCCATAC
>probe:Drosophila_2:1623464_at:357:287; Interrogation_Position=139; Antisense; CTGGCCATACCTGTGGATTTCGAAA
>probe:Drosophila_2:1623464_at:642:213; Interrogation_Position=16; Antisense; AAGTACCAATCCAGCGAACATCCAT
>probe:Drosophila_2:1623464_at:504:551; Interrogation_Position=166; Antisense; GGAGAACCACTGACACTCTTGGAAT
>probe:Drosophila_2:1623464_at:59:575; Interrogation_Position=195; Antisense; GGCGGAACAGGAGCCACAAGTTGAT
>probe:Drosophila_2:1623464_at:440:385; Interrogation_Position=31; Antisense; GAACATCCATCAATCAGCGGCCTTT
>probe:Drosophila_2:1623464_at:107:463; Interrogation_Position=317; Antisense; GATTCGGTGGTCTTGGTCACGGCTT
>probe:Drosophila_2:1623464_at:531:343; Interrogation_Position=377; Antisense; GCTTCGGTGGACTTGGCAGCTTCAA
>probe:Drosophila_2:1623464_at:143:353; Interrogation_Position=392; Antisense; GCAGCTTCAAGAGCCTATTCGGCAA
>probe:Drosophila_2:1623464_at:58:375; Interrogation_Position=417; Antisense; GAAGTTCCGCTAAAGCAACAGCACT
>probe:Drosophila_2:1623464_at:465:359; Interrogation_Position=431; Antisense; GCAACAGCACTCACCCAAAATATAG
>probe:Drosophila_2:1623464_at:181:119; Interrogation_Position=46; Antisense; AGCGGCCTTTAATCTGTTTGAATCC
>probe:Drosophila_2:1623464_at:122:479; Interrogation_Position=61; Antisense; GTTTGAATCCCTTCGAGACGTACAA
>probe:Drosophila_2:1623464_at:366:183; Interrogation_Position=85; Antisense; AAAATGAAGTTCCTTGCCCTGAGTC

Paste this into a BLAST search page for me
GTGATCTCCTGCTCTCTGGCCATACCTGGCCATACCTGTGGATTTCGAAAAAGTACCAATCCAGCGAACATCCATGGAGAACCACTGACACTCTTGGAATGGCGGAACAGGAGCCACAAGTTGATGAACATCCATCAATCAGCGGCCTTTGATTCGGTGGTCTTGGTCACGGCTTGCTTCGGTGGACTTGGCAGCTTCAAGCAGCTTCAAGAGCCTATTCGGCAAGAAGTTCCGCTAAAGCAACAGCACTGCAACAGCACTCACCCAAAATATAGAGCGGCCTTTAATCTGTTTGAATCCGTTTGAATCCCTTCGAGACGTACAAAAAATGAAGTTCCTTGCCCTGAGTC

Full Affymetrix probeset data:

Annotations for 1623464_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720