Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623466_at:

>probe:Drosophila_2:1623466_at:297:461; Interrogation_Position=4384; Antisense; GATTTATTTGGCAAGTCTGGCGACA
>probe:Drosophila_2:1623466_at:347:499; Interrogation_Position=4398; Antisense; GTCTGGCGACATTACGATACGATTG
>probe:Drosophila_2:1623466_at:683:71; Interrogation_Position=4478; Antisense; AGGCATTTAGGCATACTTTCGGCAA
>probe:Drosophila_2:1623466_at:367:279; Interrogation_Position=4488; Antisense; GCATACTTTCGGCAACGTTTGGTTT
>probe:Drosophila_2:1623466_at:652:479; Interrogation_Position=4504; Antisense; GTTTGGTTTGGCAAGCACACAATTG
>probe:Drosophila_2:1623466_at:181:153; Interrogation_Position=4567; Antisense; ACATGACTATTTTTGCATACGCAAG
>probe:Drosophila_2:1623466_at:308:359; Interrogation_Position=4587; Antisense; GCAAGAACATCTACCATAGCCATAG
>probe:Drosophila_2:1623466_at:464:673; Interrogation_Position=4603; Antisense; TAGCCATAGCCCGTATATAAGCACA
>probe:Drosophila_2:1623466_at:287:91; Interrogation_Position=4639; Antisense; AGTATCTATGTAATCCCAGTTCCCC
>probe:Drosophila_2:1623466_at:193:249; Interrogation_Position=4664; Antisense; CAATAGACTTTGATGTTCCCACACG
>probe:Drosophila_2:1623466_at:647:443; Interrogation_Position=4675; Antisense; GATGTTCCCACACGTATCGAAACTT
>probe:Drosophila_2:1623466_at:273:91; Interrogation_Position=4744; Antisense; AGTTAGCGGCTAAATCTCCTGGATA
>probe:Drosophila_2:1623466_at:215:489; Interrogation_Position=4781; Antisense; GTACGATCTGGATCAGCGTCCAAGT
>probe:Drosophila_2:1623466_at:240:505; Interrogation_Position=4804; Antisense; GTCCACGTCCAAAACTCAACATTTT

Paste this into a BLAST search page for me
GATTTATTTGGCAAGTCTGGCGACAGTCTGGCGACATTACGATACGATTGAGGCATTTAGGCATACTTTCGGCAAGCATACTTTCGGCAACGTTTGGTTTGTTTGGTTTGGCAAGCACACAATTGACATGACTATTTTTGCATACGCAAGGCAAGAACATCTACCATAGCCATAGTAGCCATAGCCCGTATATAAGCACAAGTATCTATGTAATCCCAGTTCCCCCAATAGACTTTGATGTTCCCACACGGATGTTCCCACACGTATCGAAACTTAGTTAGCGGCTAAATCTCCTGGATAGTACGATCTGGATCAGCGTCCAAGTGTCCACGTCCAAAACTCAACATTTT

Full Affymetrix probeset data:

Annotations for 1623466_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime