FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623467_at:

>probe:Drosophila_2:1623467_at:349:371; Interrogation_Position=15; Antisense; GAAGGCCACTACTATTCTAGCCGTT
>probe:Drosophila_2:1623467_at:91:439; Interrogation_Position=160; Antisense; GAGGCAGCCGCCGATACAACCAGTA
>probe:Drosophila_2:1623467_at:529:407; Interrogation_Position=272; Antisense; GACGGCGAAAGATCGTGCGCATCAC
>probe:Drosophila_2:1623467_at:287:11; Interrogation_Position=28; Antisense; ATTCTAGCCGTTGTTTCCGTGCTCA
>probe:Drosophila_2:1623467_at:135:215; Interrogation_Position=298; Antisense; AATCTGCGCTACACCAACGTTCGGC
>probe:Drosophila_2:1623467_at:99:347; Interrogation_Position=323; Antisense; GCATCCGCGTCAACCGGAATGGATC
>probe:Drosophila_2:1623467_at:328:551; Interrogation_Position=350; Antisense; GGAGCACCACCGTCCGGAATCGGAG
>probe:Drosophila_2:1623467_at:121:349; Interrogation_Position=377; Antisense; GCAGGAACAACTCCAGACGTGTCAA
>probe:Drosophila_2:1623467_at:12:139; Interrogation_Position=393; Antisense; ACGTGTCAACGTGAGGCGGGCCAAT
>probe:Drosophila_2:1623467_at:689:413; Interrogation_Position=405; Antisense; GAGGCGGGCCAATGGAAACGTTATT
>probe:Drosophila_2:1623467_at:705:389; Interrogation_Position=419; Antisense; GAAACGTTATTGTTGTCGGCTAAGT
>probe:Drosophila_2:1623467_at:449:431; Interrogation_Position=433; Antisense; GTCGGCTAAGTACGCGGAATTCAAT
>probe:Drosophila_2:1623467_at:224:651; Interrogation_Position=50; Antisense; TCACCGCTTGTCTTTTGAGGAGCAG
>probe:Drosophila_2:1623467_at:598:49; Interrogation_Position=98; Antisense; ATGCCACTGTCACAGGATGCATTGA

Paste this into a BLAST search page for me
GAAGGCCACTACTATTCTAGCCGTTGAGGCAGCCGCCGATACAACCAGTAGACGGCGAAAGATCGTGCGCATCACATTCTAGCCGTTGTTTCCGTGCTCAAATCTGCGCTACACCAACGTTCGGCGCATCCGCGTCAACCGGAATGGATCGGAGCACCACCGTCCGGAATCGGAGGCAGGAACAACTCCAGACGTGTCAAACGTGTCAACGTGAGGCGGGCCAATGAGGCGGGCCAATGGAAACGTTATTGAAACGTTATTGTTGTCGGCTAAGTGTCGGCTAAGTACGCGGAATTCAATTCACCGCTTGTCTTTTGAGGAGCAGATGCCACTGTCACAGGATGCATTGA

Full Affymetrix probeset data:

Annotations for 1623467_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720