Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623468_at:

>probe:Drosophila_2:1623468_at:572:371; Interrogation_Position=309; Antisense; GAAGCGGGAGCTACAACGTACCAAC
>probe:Drosophila_2:1623468_at:411:581; Interrogation_Position=365; Antisense; TGGCCATGGGCATCAACACATCCAA
>probe:Drosophila_2:1623468_at:213:151; Interrogation_Position=382; Antisense; ACATCCAACGTTTCGCTGAGTCTGA
>probe:Drosophila_2:1623468_at:713:123; Interrogation_Position=422; Antisense; AGCGCAGTGCCGTGGACGTGTACAA
>probe:Drosophila_2:1623468_at:297:353; Interrogation_Position=540; Antisense; GCAGCTCCATGGATTTGCGCAGCAG
>probe:Drosophila_2:1623468_at:499:183; Interrogation_Position=569; Antisense; AAAAGCTCATGCCAACCGGCGGTGA
>probe:Drosophila_2:1623468_at:400:607; Interrogation_Position=591; Antisense; TGAGTCTCCGCCAGATGCTTTTACA
>probe:Drosophila_2:1623468_at:291:75; Interrogation_Position=626; Antisense; AGGAGAAGCTTCTGACCATAGCCGC
>probe:Drosophila_2:1623468_at:47:681; Interrogation_Position=654; Antisense; TATGGAACAGCTCAACTACCTGCGC
>probe:Drosophila_2:1623468_at:111:251; Interrogation_Position=705; Antisense; CAATGAGATACTCGCCACCGGGAGT
>probe:Drosophila_2:1623468_at:261:101; Interrogation_Position=756; Antisense; AGAGGTGCTTACCTATACGCTTCTC
>probe:Drosophila_2:1623468_at:212:29; Interrogation_Position=770; Antisense; ATACGCTTCTCCAAGTCAGCAGCTA
>probe:Drosophila_2:1623468_at:206:263; Interrogation_Position=786; Antisense; CAGCAGCTACAATATGGCCATGATT
>probe:Drosophila_2:1623468_at:407:579; Interrogation_Position=801; Antisense; GGCCATGATTTGAAAACCTCGCTTA

Paste this into a BLAST search page for me
GAAGCGGGAGCTACAACGTACCAACTGGCCATGGGCATCAACACATCCAAACATCCAACGTTTCGCTGAGTCTGAAGCGCAGTGCCGTGGACGTGTACAAGCAGCTCCATGGATTTGCGCAGCAGAAAAGCTCATGCCAACCGGCGGTGATGAGTCTCCGCCAGATGCTTTTACAAGGAGAAGCTTCTGACCATAGCCGCTATGGAACAGCTCAACTACCTGCGCCAATGAGATACTCGCCACCGGGAGTAGAGGTGCTTACCTATACGCTTCTCATACGCTTCTCCAAGTCAGCAGCTACAGCAGCTACAATATGGCCATGATTGGCCATGATTTGAAAACCTCGCTTA

Full Affymetrix probeset data:

Annotations for 1623468_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime