FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623470_at:

>probe:Drosophila_2:1623470_at:193:531; Interrogation_Position=1017; Antisense; GGGTCAGTACATGCAGCCCACGAAT
>probe:Drosophila_2:1623470_at:201:125; Interrogation_Position=1031; Antisense; AGCCCACGAATAAGCACCTCAAGGT
>probe:Drosophila_2:1623470_at:441:223; Interrogation_Position=1051; Antisense; AAGGTCATCGAATACGTCACGCCCG
>probe:Drosophila_2:1623470_at:61:495; Interrogation_Position=1066; Antisense; GTCACGCCCGAGAAGTTCAAGCACT
>probe:Drosophila_2:1623470_at:720:651; Interrogation_Position=1082; Antisense; TCAAGCACTGGGAAGAGCGCGGCAA
>probe:Drosophila_2:1623470_at:373:359; Interrogation_Position=1103; Antisense; GCAACGAACTGGGTTTCCTGTACAC
>probe:Drosophila_2:1623470_at:496:575; Interrogation_Position=1165; Antisense; GGCGAGTTCTTCATCACAAGTATAT
>probe:Drosophila_2:1623470_at:165:713; Interrogation_Position=1246; Antisense; TTCTAAGCCTTTCCTAGTCGATCAT
>probe:Drosophila_2:1623470_at:659:705; Interrogation_Position=1284; Antisense; TTAGCCTTTTATTCGCTACACACGC
>probe:Drosophila_2:1623470_at:683:339; Interrogation_Position=1298; Antisense; GCTACACACGCGCATGTTGTGCAAT
>probe:Drosophila_2:1623470_at:571:103; Interrogation_Position=815; Antisense; AGACGGTTGAGAAGCTCACTCCCTA
>probe:Drosophila_2:1623470_at:617:69; Interrogation_Position=869; Antisense; AGACCCTGCAAGTGCTAACCGAAGC
>probe:Drosophila_2:1623470_at:236:681; Interrogation_Position=933; Antisense; TATGCTGGGACTTGGCGAGACCGAC
>probe:Drosophila_2:1623470_at:324:317; Interrogation_Position=998; Antisense; GCGTAGATTGCGTGACCCTGGGTCA

Paste this into a BLAST search page for me
GGGTCAGTACATGCAGCCCACGAATAGCCCACGAATAAGCACCTCAAGGTAAGGTCATCGAATACGTCACGCCCGGTCACGCCCGAGAAGTTCAAGCACTTCAAGCACTGGGAAGAGCGCGGCAAGCAACGAACTGGGTTTCCTGTACACGGCGAGTTCTTCATCACAAGTATATTTCTAAGCCTTTCCTAGTCGATCATTTAGCCTTTTATTCGCTACACACGCGCTACACACGCGCATGTTGTGCAATAGACGGTTGAGAAGCTCACTCCCTAAGACCCTGCAAGTGCTAACCGAAGCTATGCTGGGACTTGGCGAGACCGACGCGTAGATTGCGTGACCCTGGGTCA

Full Affymetrix probeset data:

Annotations for 1623470_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720