FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623472_at:

>probe:Drosophila_2:1623472_at:631:97; Interrogation_Position=1232; Antisense; AGATCTGAAGCAAGCCCTGCTGGAC
>probe:Drosophila_2:1623472_at:392:559; Interrogation_Position=1253; Antisense; GGACACCTATAACTATGCGCAGCAT
>probe:Drosophila_2:1623472_at:679:33; Interrogation_Position=1276; Antisense; ATCACGGCTGGTACGAGACCTGGAA
>probe:Drosophila_2:1623472_at:129:223; Interrogation_Position=1347; Antisense; AAGGTCTTGGGCGTAAGTGCCACCG
>probe:Drosophila_2:1623472_at:677:343; Interrogation_Position=1371; Antisense; GCTTCGCAGGCAGAGATCACCGCTG
>probe:Drosophila_2:1623472_at:730:335; Interrogation_Position=1392; Antisense; GCTGCGTACAGGAAGCTCTCCAAGG
>probe:Drosophila_2:1623472_at:528:309; Interrogation_Position=1463; Antisense; CCACCAGCGCTTTATCGAAATCCAG
>probe:Drosophila_2:1623472_at:697:267; Interrogation_Position=1488; Antisense; CAGGCGTACAGTGTGCTCAGCAAGA
>probe:Drosophila_2:1623472_at:153:361; Interrogation_Position=1507; Antisense; GCAAGATCAAGTCCAACCGGCGGCG
>probe:Drosophila_2:1623472_at:683:303; Interrogation_Position=1523; Antisense; CCGGCGGCGCAAGAACAAACAGTAC
>probe:Drosophila_2:1623472_at:631:77; Interrogation_Position=1555; Antisense; AGGAGGCCATCGTCCTTTGAGCGGC
>probe:Drosophila_2:1623472_at:46:343; Interrogation_Position=1580; Antisense; GCTTTCCTCCATCTAGTCTAAGTAT
>probe:Drosophila_2:1623472_at:182:121; Interrogation_Position=1735; Antisense; AGCTGTATCTGTTTCCACATGTATT
>probe:Drosophila_2:1623472_at:664:237; Interrogation_Position=1770; Antisense; AATCTGCGTTGTTTATTGTCAAGAC

Paste this into a BLAST search page for me
AGATCTGAAGCAAGCCCTGCTGGACGGACACCTATAACTATGCGCAGCATATCACGGCTGGTACGAGACCTGGAAAAGGTCTTGGGCGTAAGTGCCACCGGCTTCGCAGGCAGAGATCACCGCTGGCTGCGTACAGGAAGCTCTCCAAGGCCACCAGCGCTTTATCGAAATCCAGCAGGCGTACAGTGTGCTCAGCAAGAGCAAGATCAAGTCCAACCGGCGGCGCCGGCGGCGCAAGAACAAACAGTACAGGAGGCCATCGTCCTTTGAGCGGCGCTTTCCTCCATCTAGTCTAAGTATAGCTGTATCTGTTTCCACATGTATTAATCTGCGTTGTTTATTGTCAAGAC

Full Affymetrix probeset data:

Annotations for 1623472_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720