FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623473_at:

>probe:Drosophila_2:1623473_at:113:353; Interrogation_Position=2603; Antisense; GCACGCCAGTGATGTGTGGTCCTTT
>probe:Drosophila_2:1623473_at:203:631; Interrogation_Position=2622; Antisense; TCCTTTGGCGTGACCATCTGGGAGA
>probe:Drosophila_2:1623473_at:95:41; Interrogation_Position=2637; Antisense; ATCTGGGAGATGTTTTCCCTCGGCG
>probe:Drosophila_2:1623473_at:547:597; Interrogation_Position=2742; Antisense; TGTCCAGCTTACATCTATGCCGTGA
>probe:Drosophila_2:1623473_at:302:171; Interrogation_Position=2793; Antisense; AAAGATCGGCCAACCTTTGTCTATC
>probe:Drosophila_2:1623473_at:500:725; Interrogation_Position=2809; Antisense; TTGTCTATCTCACCGAGTTTTTCGC
>probe:Drosophila_2:1623473_at:244:447; Interrogation_Position=2838; Antisense; GATCCTGATTACCAAAACCTGCCGG
>probe:Drosophila_2:1623473_at:377:505; Interrogation_Position=2868; Antisense; GTGCAAACGGTTCACATTTAAGCCA
>probe:Drosophila_2:1623473_at:311:697; Interrogation_Position=2884; Antisense; TTTAAGCCAGTTTCCATTTTCCATT
>probe:Drosophila_2:1623473_at:497:629; Interrogation_Position=2903; Antisense; TCCATTTTTTCCGTTCTGAGTGCAA
>probe:Drosophila_2:1623473_at:82:231; Interrogation_Position=2948; Antisense; AATGTCTTCTATTTCGTTTTCAACG
>probe:Drosophila_2:1623473_at:670:135; Interrogation_Position=2970; Antisense; ACGTATTAACGATCTGGAACCCACA
>probe:Drosophila_2:1623473_at:177:35; Interrogation_Position=2996; Antisense; ATCACTATTGTTGTTCCGTATCCTA
>probe:Drosophila_2:1623473_at:195:471; Interrogation_Position=3008; Antisense; GTTCCGTATCCTAGTATTCATGTTT

Paste this into a BLAST search page for me
GCACGCCAGTGATGTGTGGTCCTTTTCCTTTGGCGTGACCATCTGGGAGAATCTGGGAGATGTTTTCCCTCGGCGTGTCCAGCTTACATCTATGCCGTGAAAAGATCGGCCAACCTTTGTCTATCTTGTCTATCTCACCGAGTTTTTCGCGATCCTGATTACCAAAACCTGCCGGGTGCAAACGGTTCACATTTAAGCCATTTAAGCCAGTTTCCATTTTCCATTTCCATTTTTTCCGTTCTGAGTGCAAAATGTCTTCTATTTCGTTTTCAACGACGTATTAACGATCTGGAACCCACAATCACTATTGTTGTTCCGTATCCTAGTTCCGTATCCTAGTATTCATGTTT

Full Affymetrix probeset data:

Annotations for 1623473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720