FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623474_at:

>probe:Drosophila_2:1623474_at:437:549; Interrogation_Position=131; Antisense; GGAGTCCTTTCGATGCGGCAAATCA
>probe:Drosophila_2:1623474_at:421:163; Interrogation_Position=150; Antisense; AAATCAGTCCGTCAGCTTGGGTTTC
>probe:Drosophila_2:1623474_at:525:605; Interrogation_Position=177; Antisense; TGATCAGGATGCTGACTTTCCTCCA
>probe:Drosophila_2:1623474_at:24:175; Interrogation_Position=207; Antisense; AAAGCGTCGTCGTTTGGGATCCTCA
>probe:Drosophila_2:1623474_at:250:659; Interrogation_Position=269; Antisense; TAACCGAGGCCATCCAAGACATCTT
>probe:Drosophila_2:1623474_at:514:401; Interrogation_Position=286; Antisense; GACATCTTCAAGTACCACGTCAATA
>probe:Drosophila_2:1623474_at:66:707; Interrogation_Position=322; Antisense; TTCCCGAAGAAGGAGCGTTCACCGA
>probe:Drosophila_2:1623474_at:21:711; Interrogation_Position=339; Antisense; TTCACCGAAGGATCAGGAGCGCCGC
>probe:Drosophila_2:1623474_at:586:553; Interrogation_Position=354; Antisense; GGAGCGCCGCAACAAGAACACAATT
>probe:Drosophila_2:1623474_at:386:97; Interrogation_Position=464; Antisense; AGATCGCCGAACAGAGTCTGCGTGC
>probe:Drosophila_2:1623474_at:316:329; Interrogation_Position=483; Antisense; GCGTGCCAGGGTCTATTTGAATCAT
>probe:Drosophila_2:1623474_at:273:209; Interrogation_Position=523; Antisense; AAGCAGGAAGACCACCCGCTAGTAT
>probe:Drosophila_2:1623474_at:55:429; Interrogation_Position=579; Antisense; GAGTAACTTTAGCATCGACTACCTG
>probe:Drosophila_2:1623474_at:79:375; Interrogation_Position=91; Antisense; GAAGAGCTAATCTCCCGGAGCGGCA

Paste this into a BLAST search page for me
GGAGTCCTTTCGATGCGGCAAATCAAAATCAGTCCGTCAGCTTGGGTTTCTGATCAGGATGCTGACTTTCCTCCAAAAGCGTCGTCGTTTGGGATCCTCATAACCGAGGCCATCCAAGACATCTTGACATCTTCAAGTACCACGTCAATATTCCCGAAGAAGGAGCGTTCACCGATTCACCGAAGGATCAGGAGCGCCGCGGAGCGCCGCAACAAGAACACAATTAGATCGCCGAACAGAGTCTGCGTGCGCGTGCCAGGGTCTATTTGAATCATAAGCAGGAAGACCACCCGCTAGTATGAGTAACTTTAGCATCGACTACCTGGAAGAGCTAATCTCCCGGAGCGGCA

Full Affymetrix probeset data:

Annotations for 1623474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720