Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623478_at:

>probe:Drosophila_2:1623478_at:658:709; Interrogation_Position=2532; Antisense; TTAAGTGTCTGTTCTATTCCCGCGA
>probe:Drosophila_2:1623478_at:545:7; Interrogation_Position=2547; Antisense; ATTCCCGCGAATAAGACACAAATTT
>probe:Drosophila_2:1623478_at:323:163; Interrogation_Position=2566; Antisense; AAATTTCTCCATTCGAATCTGTGTG
>probe:Drosophila_2:1623478_at:644:237; Interrogation_Position=2581; Antisense; AATCTGTGTGTATTTCTCTGTGCGT
>probe:Drosophila_2:1623478_at:531:643; Interrogation_Position=2595; Antisense; TCTCTGTGCGTTGGTGTCATATTCA
>probe:Drosophila_2:1623478_at:381:515; Interrogation_Position=2673; Antisense; GGCTAAGGGTGTACGTCTAAGTCTA
>probe:Drosophila_2:1623478_at:362:279; Interrogation_Position=2695; Antisense; CTAAGAGATGCGGTGAAACTTTCAA
>probe:Drosophila_2:1623478_at:251:391; Interrogation_Position=2813; Antisense; GAAACTCACAAGTCATAACTATCGG
>probe:Drosophila_2:1623478_at:229:407; Interrogation_Position=2881; Antisense; GACGATTAGTTTTAGCTTCTAGGGT
>probe:Drosophila_2:1623478_at:298:609; Interrogation_Position=2949; Antisense; TGAGAGCAACTTTTTGTGCGCCCAT
>probe:Drosophila_2:1623478_at:705:725; Interrogation_Position=2962; Antisense; TTGTGCGCCCATTTGTAAAATATTT
>probe:Drosophila_2:1623478_at:210:537; Interrogation_Position=3002; Antisense; GGTTCTTTAGCGTAGTTAGTTGTAG
>probe:Drosophila_2:1623478_at:601:673; Interrogation_Position=3046; Antisense; TTCGTAAACCTTTTGAGCCCCAGTG
>probe:Drosophila_2:1623478_at:190:609; Interrogation_Position=3059; Antisense; TGAGCCCCAGTGTTTACCGATTTAA

Paste this into a BLAST search page for me
TTAAGTGTCTGTTCTATTCCCGCGAATTCCCGCGAATAAGACACAAATTTAAATTTCTCCATTCGAATCTGTGTGAATCTGTGTGTATTTCTCTGTGCGTTCTCTGTGCGTTGGTGTCATATTCAGGCTAAGGGTGTACGTCTAAGTCTACTAAGAGATGCGGTGAAACTTTCAAGAAACTCACAAGTCATAACTATCGGGACGATTAGTTTTAGCTTCTAGGGTTGAGAGCAACTTTTTGTGCGCCCATTTGTGCGCCCATTTGTAAAATATTTGGTTCTTTAGCGTAGTTAGTTGTAGTTCGTAAACCTTTTGAGCCCCAGTGTGAGCCCCAGTGTTTACCGATTTAA

Full Affymetrix probeset data:

Annotations for 1623478_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime