FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623479_at:

>probe:Drosophila_2:1623479_at:427:613; Interrogation_Position=3020; Antisense; TGAACGAAAAGGTACGCGGCGGCAA
>probe:Drosophila_2:1623479_at:528:205; Interrogation_Position=3043; Antisense; AAGCGCATGCTGAGCTTTGGCGACG
>probe:Drosophila_2:1623479_at:124:325; Interrogation_Position=3062; Antisense; GCGACGAGCCCGGACTAGGTACAAT
>probe:Drosophila_2:1623479_at:137:411; Interrogation_Position=3093; Antisense; GACGAAGCGCTCGAAAATCAGCCAG
>probe:Drosophila_2:1623479_at:437:239; Interrogation_Position=3108; Antisense; AATCAGCCAGGTCAAGGCCGTCATG
>probe:Drosophila_2:1623479_at:504:65; Interrogation_Position=3130; Antisense; ATGGACGACCCTGAACTGCAGTCAG
>probe:Drosophila_2:1623479_at:48:351; Interrogation_Position=3162; Antisense; GCAGACTGCTGTTACCACGGAAGGT
>probe:Drosophila_2:1623479_at:86:163; Interrogation_Position=3267; Antisense; AAATTCGGCGCAGAAGGCCACACAC
>probe:Drosophila_2:1623479_at:717:575; Interrogation_Position=3302; Antisense; GGCGCACGTTCGACTATTTTATGAT
>probe:Drosophila_2:1623479_at:295:149; Interrogation_Position=3392; Antisense; ACATCTTTTAATTTTGCTCAACGCC
>probe:Drosophila_2:1623479_at:15:135; Interrogation_Position=3412; Antisense; ACGCCAGCCAACCATATAATTCATA
>probe:Drosophila_2:1623479_at:713:11; Interrogation_Position=3430; Antisense; ATTCATATGCTAACCCAATACTTTG
>probe:Drosophila_2:1623479_at:236:277; Interrogation_Position=3466; Antisense; CTAAATACTTGATCACCACACACAC
>probe:Drosophila_2:1623479_at:661:325; Interrogation_Position=3506; Antisense; GCGACTCCCCGCGATTTAAAAATCA

Paste this into a BLAST search page for me
TGAACGAAAAGGTACGCGGCGGCAAAAGCGCATGCTGAGCTTTGGCGACGGCGACGAGCCCGGACTAGGTACAATGACGAAGCGCTCGAAAATCAGCCAGAATCAGCCAGGTCAAGGCCGTCATGATGGACGACCCTGAACTGCAGTCAGGCAGACTGCTGTTACCACGGAAGGTAAATTCGGCGCAGAAGGCCACACACGGCGCACGTTCGACTATTTTATGATACATCTTTTAATTTTGCTCAACGCCACGCCAGCCAACCATATAATTCATAATTCATATGCTAACCCAATACTTTGCTAAATACTTGATCACCACACACACGCGACTCCCCGCGATTTAAAAATCA

Full Affymetrix probeset data:

Annotations for 1623479_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720