FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623480_at:

>probe:Drosophila_2:1623480_at:121:429; Interrogation_Position=526; Antisense; GAGATTCTCGGACGAAGCCAGGCAA
>probe:Drosophila_2:1623480_at:61:49; Interrogation_Position=567; Antisense; ATCCTTATTGGCTGATGTTCTCCAC
>probe:Drosophila_2:1623480_at:7:545; Interrogation_Position=601; Antisense; GGATCGTCGATTGGGTTACTTCCAA
>probe:Drosophila_2:1623480_at:323:59; Interrogation_Position=648; Antisense; ATGATCTGCGACTGTTGGCCACCAG
>probe:Drosophila_2:1623480_at:21:109; Interrogation_Position=673; Antisense; AGAACCCAATGCCATTACCTACAAT
>probe:Drosophila_2:1623480_at:201:25; Interrogation_Position=696; Antisense; ATATGGAACACCTCCGCAAGTCTGT
>probe:Drosophila_2:1623480_at:381:361; Interrogation_Position=711; Antisense; GCAAGTCTGTGTTCACCCTTAAGGA
>probe:Drosophila_2:1623480_at:614:609; Interrogation_Position=766; Antisense; TGACCTGGTGGTACGAAAGCCGCGC
>probe:Drosophila_2:1623480_at:111:317; Interrogation_Position=789; Antisense; GCCTCTTGATGATTCCTCCGGATGA
>probe:Drosophila_2:1623480_at:586:631; Interrogation_Position=805; Antisense; TCCGGATGATCTTGTCGAGCGATTT
>probe:Drosophila_2:1623480_at:572:415; Interrogation_Position=821; Antisense; GAGCGATTTAGTTACATTCACCAGG
>probe:Drosophila_2:1623480_at:324:13; Interrogation_Position=836; Antisense; ATTCACCAGGATATGGGCCTTCCAC
>probe:Drosophila_2:1623480_at:682:93; Interrogation_Position=867; Antisense; AGATTGTCCAGTGCCCGGAGCTTTT
>probe:Drosophila_2:1623480_at:62:341; Interrogation_Position=886; Antisense; GCTTTTGGCCTCACGCGAATTTAGA

Paste this into a BLAST search page for me
GAGATTCTCGGACGAAGCCAGGCAAATCCTTATTGGCTGATGTTCTCCACGGATCGTCGATTGGGTTACTTCCAAATGATCTGCGACTGTTGGCCACCAGAGAACCCAATGCCATTACCTACAATATATGGAACACCTCCGCAAGTCTGTGCAAGTCTGTGTTCACCCTTAAGGATGACCTGGTGGTACGAAAGCCGCGCGCCTCTTGATGATTCCTCCGGATGATCCGGATGATCTTGTCGAGCGATTTGAGCGATTTAGTTACATTCACCAGGATTCACCAGGATATGGGCCTTCCACAGATTGTCCAGTGCCCGGAGCTTTTGCTTTTGGCCTCACGCGAATTTAGA

Full Affymetrix probeset data:

Annotations for 1623480_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720