FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623481_at:

>probe:Drosophila_2:1623481_at:43:477; Interrogation_Position=1029; Antisense; GTTTTGCTTTTGGATGTGGCTGTAA
>probe:Drosophila_2:1623481_at:595:241; Interrogation_Position=1088; Antisense; AATAGCATTTCCGACTCTTTTTGAT
>probe:Drosophila_2:1623481_at:130:405; Interrogation_Position=1100; Antisense; GACTCTTTTTGATGCTGCCTCTGCT
>probe:Drosophila_2:1623481_at:197:283; Interrogation_Position=1114; Antisense; CTGCCTCTGCTCCTTTAAAATCGAG
>probe:Drosophila_2:1623481_at:26:273; Interrogation_Position=1159; Antisense; CATTTAAAGAACACGCCCCAATTTG
>probe:Drosophila_2:1623481_at:460:379; Interrogation_Position=1183; Antisense; GAACCGTACAAATCAAGGCATTAAA
>probe:Drosophila_2:1623481_at:46:477; Interrogation_Position=1260; Antisense; GTTATTCTTAGAGTGCAGCCTTGAC
>probe:Drosophila_2:1623481_at:544:353; Interrogation_Position=1274; Antisense; GCAGCCTTGACAAAAGCTATAGTTG
>probe:Drosophila_2:1623481_at:353:467; Interrogation_Position=1295; Antisense; GTTGTTACTATAATTCACGTTGTGA
>probe:Drosophila_2:1623481_at:480:293; Interrogation_Position=1312; Antisense; CGTTGTGATGTGATCTTGTTCCATA
>probe:Drosophila_2:1623481_at:98:65; Interrogation_Position=1417; Antisense; ATGGGAGTCATTTTCGTGGCAATAT
>probe:Drosophila_2:1623481_at:440:389; Interrogation_Position=902; Antisense; GAAAACTGAGACTGATGACACCAAA
>probe:Drosophila_2:1623481_at:332:31; Interrogation_Position=973; Antisense; ATAACGCACAAGATCAGGCCACTCC
>probe:Drosophila_2:1623481_at:164:631; Interrogation_Position=995; Antisense; TCCTTCTACCGACTGTTAGCGAATC

Paste this into a BLAST search page for me
GTTTTGCTTTTGGATGTGGCTGTAAAATAGCATTTCCGACTCTTTTTGATGACTCTTTTTGATGCTGCCTCTGCTCTGCCTCTGCTCCTTTAAAATCGAGCATTTAAAGAACACGCCCCAATTTGGAACCGTACAAATCAAGGCATTAAAGTTATTCTTAGAGTGCAGCCTTGACGCAGCCTTGACAAAAGCTATAGTTGGTTGTTACTATAATTCACGTTGTGACGTTGTGATGTGATCTTGTTCCATAATGGGAGTCATTTTCGTGGCAATATGAAAACTGAGACTGATGACACCAAAATAACGCACAAGATCAGGCCACTCCTCCTTCTACCGACTGTTAGCGAATC

Full Affymetrix probeset data:

Annotations for 1623481_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720