Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623482_at:

>probe:Drosophila_2:1623482_at:549:703; Interrogation_Position=111; Antisense; TTATCGGCCGTGCAGGCCAACGATA
>probe:Drosophila_2:1623482_at:78:479; Interrogation_Position=157; Antisense; GTTTCCAGAGTCGTCCCACGGATAA
>probe:Drosophila_2:1623482_at:656:123; Interrogation_Position=16; Antisense; AGCCCAATGTCGGTGCCTACATATT
>probe:Drosophila_2:1623482_at:271:133; Interrogation_Position=174; Antisense; ACGGATAACGTCTACTCGGATCCAC
>probe:Drosophila_2:1623482_at:211:421; Interrogation_Position=204; Antisense; GAGCAACTGATTGTCTATCGGGCTT
>probe:Drosophila_2:1623482_at:228:683; Interrogation_Position=219; Antisense; TATCGGGCTTTGTTGCAGCACCTGC
>probe:Drosophila_2:1623482_at:587:339; Interrogation_Position=301; Antisense; GCTTTCGCAGCGAGGGAGCCAACGA
>probe:Drosophila_2:1623482_at:512:137; Interrogation_Position=322; Antisense; ACGAGCGCCGTTTGCAGATCCAGGA
>probe:Drosophila_2:1623482_at:473:621; Interrogation_Position=373; Antisense; TGCTGCCTGGCATCGTTTTCAAAAT
>probe:Drosophila_2:1623482_at:686:585; Interrogation_Position=409; Antisense; TGGACAAGCTGAAGCGCTTCCTCGA
>probe:Drosophila_2:1623482_at:593:397; Interrogation_Position=480; Antisense; GACAACTGCGTCGAGCTACTCAATA
>probe:Drosophila_2:1623482_at:422:37; Interrogation_Position=49; Antisense; ATCTCATCCGTTATCCGTTGTAGTG
>probe:Drosophila_2:1623482_at:247:241; Interrogation_Position=501; Antisense; AATAACTGTCAATCTTCTCTGGAAA
>probe:Drosophila_2:1623482_at:278:293; Interrogation_Position=64; Antisense; CGTTGTAGTGATCAGTTAGTGCCAT

Paste this into a BLAST search page for me
TTATCGGCCGTGCAGGCCAACGATAGTTTCCAGAGTCGTCCCACGGATAAAGCCCAATGTCGGTGCCTACATATTACGGATAACGTCTACTCGGATCCACGAGCAACTGATTGTCTATCGGGCTTTATCGGGCTTTGTTGCAGCACCTGCGCTTTCGCAGCGAGGGAGCCAACGAACGAGCGCCGTTTGCAGATCCAGGATGCTGCCTGGCATCGTTTTCAAAATTGGACAAGCTGAAGCGCTTCCTCGAGACAACTGCGTCGAGCTACTCAATAATCTCATCCGTTATCCGTTGTAGTGAATAACTGTCAATCTTCTCTGGAAACGTTGTAGTGATCAGTTAGTGCCAT

Full Affymetrix probeset data:

Annotations for 1623482_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime