FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623483_at:

>probe:Drosophila_2:1623483_at:256:73; Interrogation_Position=1016; Antisense; AGGACATTTACGTGGGCGGCACCAA
>probe:Drosophila_2:1623483_at:229:349; Interrogation_Position=1056; Antisense; GCAGGCCATTGTGGATTCCGGAACT
>probe:Drosophila_2:1623483_at:69:79; Interrogation_Position=1124; Antisense; AGGTCATCGGATGCAGGGCTACCTC
>probe:Drosophila_2:1623483_at:225:651; Interrogation_Position=1193; Antisense; TCACCTTTGTCATCGCGGGCAAGAA
>probe:Drosophila_2:1623483_at:357:399; Interrogation_Position=1272; Antisense; GACAGTCTGCATATCGGCGGTAACT
>probe:Drosophila_2:1623483_at:490:613; Interrogation_Position=1296; Antisense; TGAAGTTCCCGACGAGCCAGTGATC
>probe:Drosophila_2:1623483_at:8:571; Interrogation_Position=1340; Antisense; GGCATTTCTGCACGGAATTCGACTT
>probe:Drosophila_2:1623483_at:247:717; Interrogation_Position=1357; Antisense; TTCGACTTGGCCAACAATCGCATTG
>probe:Drosophila_2:1623483_at:144:5; Interrogation_Position=1378; Antisense; ATTGGATTCGCTGCCACTACGTATT
>probe:Drosophila_2:1623483_at:447:595; Interrogation_Position=852; Antisense; TGTGATCACCAGTTGCAAGTTTGCC
>probe:Drosophila_2:1623483_at:116:471; Interrogation_Position=899; Antisense; GTTCCTCTCGAGGTGGTGCAATAAT
>probe:Drosophila_2:1623483_at:512:509; Interrogation_Position=914; Antisense; GTGCAATAATCTTCGGCAGCTCCAA
>probe:Drosophila_2:1623483_at:146:27; Interrogation_Position=962; Antisense; ATAGCTACACATACACTCCGGTGAC
>probe:Drosophila_2:1623483_at:534:475; Interrogation_Position=995; Antisense; GTTACTGGCAGTTCACTCTGCAGGA

Paste this into a BLAST search page for me
AGGACATTTACGTGGGCGGCACCAAGCAGGCCATTGTGGATTCCGGAACTAGGTCATCGGATGCAGGGCTACCTCTCACCTTTGTCATCGCGGGCAAGAAGACAGTCTGCATATCGGCGGTAACTTGAAGTTCCCGACGAGCCAGTGATCGGCATTTCTGCACGGAATTCGACTTTTCGACTTGGCCAACAATCGCATTGATTGGATTCGCTGCCACTACGTATTTGTGATCACCAGTTGCAAGTTTGCCGTTCCTCTCGAGGTGGTGCAATAATGTGCAATAATCTTCGGCAGCTCCAAATAGCTACACATACACTCCGGTGACGTTACTGGCAGTTCACTCTGCAGGA

Full Affymetrix probeset data:

Annotations for 1623483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720