Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623485_at:

>probe:Drosophila_2:1623485_at:515:123; Interrogation_Position=1016; Antisense; AGCGCTGACTGGATCTGAAGCCATC
>probe:Drosophila_2:1623485_at:206:301; Interrogation_Position=1070; Antisense; CCCATCTTAAGTTCCTTACTCTGTA
>probe:Drosophila_2:1623485_at:571:545; Interrogation_Position=549; Antisense; GGATGAGCGCTACGCGCTGATTACC
>probe:Drosophila_2:1623485_at:470:603; Interrogation_Position=566; Antisense; TGATTACCCGCACCGAGGCCAAGGC
>probe:Drosophila_2:1623485_at:639:143; Interrogation_Position=608; Antisense; ACTGCGATTTCGACAAGCGGGAGCC
>probe:Drosophila_2:1623485_at:685:205; Interrogation_Position=622; Antisense; AAGCGGGAGCCCAAGCTGCGGTACA
>probe:Drosophila_2:1623485_at:633:489; Interrogation_Position=642; Antisense; GTACATAAGCCGCAAGAATCCGCAC
>probe:Drosophila_2:1623485_at:376:619; Interrogation_Position=698; Antisense; TGCATCTGCAGATTCACCAGCGCGC
>probe:Drosophila_2:1623485_at:526:269; Interrogation_Position=834; Antisense; CATGGAGGTGCGCAGCAGCATCTAC
>probe:Drosophila_2:1623485_at:630:375; Interrogation_Position=864; Antisense; GAAGACGCACGAAGTTCACGAGCAC
>probe:Drosophila_2:1623485_at:425:711; Interrogation_Position=878; Antisense; TTCACGAGCACGAGTTCGGGCCGGA
>probe:Drosophila_2:1623485_at:465:637; Interrogation_Position=893; Antisense; TCGGGCCGGACACCTACGATGAAGA
>probe:Drosophila_2:1623485_at:637:371; Interrogation_Position=913; Antisense; GAAGAGGAGGACACCTACACCCACA
>probe:Drosophila_2:1623485_at:85:619; Interrogation_Position=940; Antisense; TGCATTACCTGTCCGTACAGCGAGA

Paste this into a BLAST search page for me
AGCGCTGACTGGATCTGAAGCCATCCCCATCTTAAGTTCCTTACTCTGTAGGATGAGCGCTACGCGCTGATTACCTGATTACCCGCACCGAGGCCAAGGCACTGCGATTTCGACAAGCGGGAGCCAAGCGGGAGCCCAAGCTGCGGTACAGTACATAAGCCGCAAGAATCCGCACTGCATCTGCAGATTCACCAGCGCGCCATGGAGGTGCGCAGCAGCATCTACGAAGACGCACGAAGTTCACGAGCACTTCACGAGCACGAGTTCGGGCCGGATCGGGCCGGACACCTACGATGAAGAGAAGAGGAGGACACCTACACCCACATGCATTACCTGTCCGTACAGCGAGA

Full Affymetrix probeset data:

Annotations for 1623485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime