Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623490_at:

>probe:Drosophila_2:1623490_at:76:41; Interrogation_Position=10860; Antisense; ATCGGAAATCCGTATATGAATGTGT
>probe:Drosophila_2:1623490_at:457:685; Interrogation_Position=11003; Antisense; TATAGATACCAAGCGGATGCCGTTG
>probe:Drosophila_2:1623490_at:36:207; Interrogation_Position=11013; Antisense; AAGCGGATGCCGTTGTCGAGCTCGA
>probe:Drosophila_2:1623490_at:73:597; Interrogation_Position=11026; Antisense; TGTCGAGCTCGACTGTGCTTCATCT
>probe:Drosophila_2:1623490_at:204:637; Interrogation_Position=11034; Antisense; TCGACTGTGCTTCATCTCGTACATA
>probe:Drosophila_2:1623490_at:334:637; Interrogation_Position=11050; Antisense; TCGTACATACCCCAGGTCCTCTGTT
>probe:Drosophila_2:1623490_at:690:535; Interrogation_Position=11064; Antisense; GGTCCTCTGTTCTTAAAATACTTTG
>probe:Drosophila_2:1623490_at:603:667; Interrogation_Position=11082; Antisense; TACTTTGATCTGTACATTTTCAGGA
>probe:Drosophila_2:1623490_at:185:115; Interrogation_Position=11116; Antisense; AGCTTAACCTACTTAATTAGTTGAG
>probe:Drosophila_2:1623490_at:685:71; Interrogation_Position=11150; Antisense; AGGCATATTAACTGACTAACGAAAA
>probe:Drosophila_2:1623490_at:676:223; Interrogation_Position=11174; Antisense; AAGGCCAGTCCGTTAAGGCAGTTTG
>probe:Drosophila_2:1623490_at:214:473; Interrogation_Position=11185; Antisense; GTTAAGGCAGTTTGAGCATACATAA
>probe:Drosophila_2:1623490_at:640:371; Interrogation_Position=11271; Antisense; GAAGTGCAGAGGGTATAGGCTATAA
>probe:Drosophila_2:1623490_at:686:63; Interrogation_Position=11347; Antisense; ATGGCAAGCCGATATACATACATGA

Paste this into a BLAST search page for me
ATCGGAAATCCGTATATGAATGTGTTATAGATACCAAGCGGATGCCGTTGAAGCGGATGCCGTTGTCGAGCTCGATGTCGAGCTCGACTGTGCTTCATCTTCGACTGTGCTTCATCTCGTACATATCGTACATACCCCAGGTCCTCTGTTGGTCCTCTGTTCTTAAAATACTTTGTACTTTGATCTGTACATTTTCAGGAAGCTTAACCTACTTAATTAGTTGAGAGGCATATTAACTGACTAACGAAAAAAGGCCAGTCCGTTAAGGCAGTTTGGTTAAGGCAGTTTGAGCATACATAAGAAGTGCAGAGGGTATAGGCTATAAATGGCAAGCCGATATACATACATGA

Full Affymetrix probeset data:

Annotations for 1623490_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime