FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623493_at:

>probe:Drosophila_2:1623493_at:382:459; Interrogation_Position=1790; Antisense; GATATTCCCATCAAACAGCCGTTGA
>probe:Drosophila_2:1623493_at:712:155; Interrogation_Position=1804; Antisense; ACAGCCGTTGATACTTATTTTCGAT
>probe:Drosophila_2:1623493_at:215:17; Interrogation_Position=1820; Antisense; ATTTTCGATTCGTTGGCAGTCACCT
>probe:Drosophila_2:1623493_at:471:399; Interrogation_Position=1848; Antisense; GACATCGAGCGATTGCCATATTGCG
>probe:Drosophila_2:1623493_at:160:9; Interrogation_Position=1867; Antisense; ATTGCGGGATTATCTCACCTGTGAG
>probe:Drosophila_2:1623493_at:413:251; Interrogation_Position=1894; Antisense; CAAGGCCAAGTATCCGAATGCGCTG
>probe:Drosophila_2:1623493_at:290:625; Interrogation_Position=1912; Antisense; TGCGCTGGCGCATGTCTTTAACAAG
>probe:Drosophila_2:1623493_at:251:549; Interrogation_Position=1960; Antisense; GGAGGTGCCGCAACAGCAGAATCTT
>probe:Drosophila_2:1623493_at:138:367; Interrogation_Position=1978; Antisense; GAATCTTACAGATTGCGGCCTCTAT
>probe:Drosophila_2:1623493_at:128:553; Interrogation_Position=2017; Antisense; GGAGCAATTCTTCACAAAACCCATC
>probe:Drosophila_2:1623493_at:595:651; Interrogation_Position=2040; Antisense; TCAACGACTATACACTGCCCATTAA
>probe:Drosophila_2:1623493_at:79:363; Interrogation_Position=2073; Antisense; GCAATTGGTTTGACCTGCTCACAGT
>probe:Drosophila_2:1623493_at:159:437; Interrogation_Position=2111; Antisense; GAGGATATCGCTAATCTCATCAAGA
>probe:Drosophila_2:1623493_at:232:707; Interrogation_Position=2171; Antisense; TTGCCGGTCATTAAGTTTCCGACAT

Paste this into a BLAST search page for me
GATATTCCCATCAAACAGCCGTTGAACAGCCGTTGATACTTATTTTCGATATTTTCGATTCGTTGGCAGTCACCTGACATCGAGCGATTGCCATATTGCGATTGCGGGATTATCTCACCTGTGAGCAAGGCCAAGTATCCGAATGCGCTGTGCGCTGGCGCATGTCTTTAACAAGGGAGGTGCCGCAACAGCAGAATCTTGAATCTTACAGATTGCGGCCTCTATGGAGCAATTCTTCACAAAACCCATCTCAACGACTATACACTGCCCATTAAGCAATTGGTTTGACCTGCTCACAGTGAGGATATCGCTAATCTCATCAAGATTGCCGGTCATTAAGTTTCCGACAT

Full Affymetrix probeset data:

Annotations for 1623493_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720