FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623494_at:

>probe:Drosophila_2:1623494_at:217:147; Interrogation_Position=1655; Antisense; ACTAAGCCCTATGTGGATTTCCTGC
>probe:Drosophila_2:1623494_at:148:539; Interrogation_Position=1681; Antisense; GGTTTACGATCTGCTAAAGCGCGAT
>probe:Drosophila_2:1623494_at:584:657; Interrogation_Position=1708; Antisense; TAAGGCGGCGAGTCTGAGCAAGTAC
>probe:Drosophila_2:1623494_at:22:545; Interrogation_Position=1736; Antisense; GGATATTCCGAGAATCTGCTGGTGG
>probe:Drosophila_2:1623494_at:20:593; Interrogation_Position=1755; Antisense; TGGTGGAGCTGCATGCCTTGTCACA
>probe:Drosophila_2:1623494_at:449:275; Interrogation_Position=1771; Antisense; CTTGTCACAGGTTTCGGCGGCCAGG
>probe:Drosophila_2:1623494_at:33:575; Interrogation_Position=1786; Antisense; GGCGGCCAGGCAATTGTATACTCTA
>probe:Drosophila_2:1623494_at:534:577; Interrogation_Position=1858; Antisense; GGCCCGCGTGCAGGGAATCGCCAAA
>probe:Drosophila_2:1623494_at:301:181; Interrogation_Position=1898; Antisense; AAAAGCCCCACTTCCAAGGCATTGA
>probe:Drosophila_2:1623494_at:567:71; Interrogation_Position=1914; Antisense; AGGCATTGACTTTTATTCCCAGCAT
>probe:Drosophila_2:1623494_at:494:7; Interrogation_Position=1928; Antisense; ATTCCCAGCATGCAGTTTTTACCTT
>probe:Drosophila_2:1623494_at:539:339; Interrogation_Position=1939; Antisense; GCAGTTTTTACCTTAAGCTCTTAGC
>probe:Drosophila_2:1623494_at:156:555; Interrogation_Position=1985; Antisense; GGACCTACTGACCTTACAATTGTGT
>probe:Drosophila_2:1623494_at:566:315; Interrogation_Position=2198; Antisense; GCCTTGTGCAAGGTTTCTAACATTT

Paste this into a BLAST search page for me
ACTAAGCCCTATGTGGATTTCCTGCGGTTTACGATCTGCTAAAGCGCGATTAAGGCGGCGAGTCTGAGCAAGTACGGATATTCCGAGAATCTGCTGGTGGTGGTGGAGCTGCATGCCTTGTCACACTTGTCACAGGTTTCGGCGGCCAGGGGCGGCCAGGCAATTGTATACTCTAGGCCCGCGTGCAGGGAATCGCCAAAAAAAGCCCCACTTCCAAGGCATTGAAGGCATTGACTTTTATTCCCAGCATATTCCCAGCATGCAGTTTTTACCTTGCAGTTTTTACCTTAAGCTCTTAGCGGACCTACTGACCTTACAATTGTGTGCCTTGTGCAAGGTTTCTAACATTT

Full Affymetrix probeset data:

Annotations for 1623494_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720