Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623495_at:

>probe:Drosophila_2:1623495_at:434:703; Interrogation_Position=1029; Antisense; TTATCAAGTGCTGTGCGAGTGCGGA
>probe:Drosophila_2:1623495_at:198:181; Interrogation_Position=1128; Antisense; AAAACAAACCGTCGCCAAGGAGATG
>probe:Drosophila_2:1623495_at:506:447; Interrogation_Position=1149; Antisense; GATGCGTCATCGAGTAGTGAACACA
>probe:Drosophila_2:1623495_at:557:511; Interrogation_Position=1165; Antisense; GTGAACACAGCCGATAAGCCGAGGG
>probe:Drosophila_2:1623495_at:658:157; Interrogation_Position=1221; Antisense; ACAAAGAATGTGCACCTGGTCGGAG
>probe:Drosophila_2:1623495_at:645:245; Interrogation_Position=1271; Antisense; AATTAATCGTATGCGTCTCAGCCGT
>probe:Drosophila_2:1623495_at:271:317; Interrogation_Position=1291; Antisense; GCCGTAGCGTCCTGTATTGTTGCAA
>probe:Drosophila_2:1623495_at:232:63; Interrogation_Position=1353; Antisense; ATGGAAAGCCAACCCGTTCGCAGCT
>probe:Drosophila_2:1623495_at:437:263; Interrogation_Position=1373; Antisense; CAGCTCCGTTTGCATTTAATTTGAT
>probe:Drosophila_2:1623495_at:213:605; Interrogation_Position=1394; Antisense; TGATTGGATGCCCAGTGCCACAGAA
>probe:Drosophila_2:1623495_at:14:725; Interrogation_Position=1448; Antisense; TTGATTTGGCCTTACTTTTAGTTAT
>probe:Drosophila_2:1623495_at:561:657; Interrogation_Position=1503; Antisense; TAAGTTTTAGCCATCGAATGCGAGC
>probe:Drosophila_2:1623495_at:436:369; Interrogation_Position=1518; Antisense; GAATGCGAGCCGAGCGTTTCAATAA
>probe:Drosophila_2:1623495_at:655:461; Interrogation_Position=978; Antisense; GATTCTGAGGGCAGCTCATCCAAAA

Paste this into a BLAST search page for me
TTATCAAGTGCTGTGCGAGTGCGGAAAAACAAACCGTCGCCAAGGAGATGGATGCGTCATCGAGTAGTGAACACAGTGAACACAGCCGATAAGCCGAGGGACAAAGAATGTGCACCTGGTCGGAGAATTAATCGTATGCGTCTCAGCCGTGCCGTAGCGTCCTGTATTGTTGCAAATGGAAAGCCAACCCGTTCGCAGCTCAGCTCCGTTTGCATTTAATTTGATTGATTGGATGCCCAGTGCCACAGAATTGATTTGGCCTTACTTTTAGTTATTAAGTTTTAGCCATCGAATGCGAGCGAATGCGAGCCGAGCGTTTCAATAAGATTCTGAGGGCAGCTCATCCAAAA

Full Affymetrix probeset data:

Annotations for 1623495_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime