Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623496_at:

>probe:Drosophila_2:1623496_at:220:547; Interrogation_Position=3295; Antisense; GGATCCTGCTCCCAGATTTGATAAA
>probe:Drosophila_2:1623496_at:251:215; Interrogation_Position=3329; Antisense; AAGATCTTCTGTCACGTGGATGCCA
>probe:Drosophila_2:1623496_at:636:183; Interrogation_Position=3411; Antisense; AAAAGGCCTGCTGTTACTTCGGAAT
>probe:Drosophila_2:1623496_at:426:667; Interrogation_Position=3425; Antisense; TACTTCGGAATGTTTCTGCTGGATG
>probe:Drosophila_2:1623496_at:590:435; Interrogation_Position=3463; Antisense; GAGGTTAGCAGACTTCCGGAGCAAA
>probe:Drosophila_2:1623496_at:170:551; Interrogation_Position=3480; Antisense; GGAGCAAACTAAAGTCCACACCCGC
>probe:Drosophila_2:1623496_at:162:633; Interrogation_Position=3506; Antisense; TCCGTAATCAAGAGCTGGTCCAGTA
>probe:Drosophila_2:1623496_at:664:539; Interrogation_Position=3541; Antisense; GGTATTGCGCTTTAAGCGCGCTCTA
>probe:Drosophila_2:1623496_at:536:323; Interrogation_Position=3556; Antisense; GCGCGCTCTAATTACCAAGCAGATC
>probe:Drosophila_2:1623496_at:469:267; Interrogation_Position=3590; Antisense; CAGGCTCTGATCGACCAATGGAATA
>probe:Drosophila_2:1623496_at:118:63; Interrogation_Position=3607; Antisense; ATGGAATAGCGATCCTCACTTCCTT
>probe:Drosophila_2:1623496_at:128:431; Interrogation_Position=3638; Antisense; GAGTATCAGAACCTGCTCTACGACG
>probe:Drosophila_2:1623496_at:209:337; Interrogation_Position=3652; Antisense; GCTCTACGACGTGGCGCTTAGCGAA
>probe:Drosophila_2:1623496_at:124:707; Interrogation_Position=3669; Antisense; TTAGCGAACTGACGCCTTTATGGCC

Paste this into a BLAST search page for me
GGATCCTGCTCCCAGATTTGATAAAAAGATCTTCTGTCACGTGGATGCCAAAAAGGCCTGCTGTTACTTCGGAATTACTTCGGAATGTTTCTGCTGGATGGAGGTTAGCAGACTTCCGGAGCAAAGGAGCAAACTAAAGTCCACACCCGCTCCGTAATCAAGAGCTGGTCCAGTAGGTATTGCGCTTTAAGCGCGCTCTAGCGCGCTCTAATTACCAAGCAGATCCAGGCTCTGATCGACCAATGGAATAATGGAATAGCGATCCTCACTTCCTTGAGTATCAGAACCTGCTCTACGACGGCTCTACGACGTGGCGCTTAGCGAATTAGCGAACTGACGCCTTTATGGCC

Full Affymetrix probeset data:

Annotations for 1623496_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime