FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623497_at:

>probe:Drosophila_2:1623497_at:25:323; Interrogation_Position=1001; Antisense; GCCCAATATGGATCTTATCCCTAAT
>probe:Drosophila_2:1623497_at:123:179; Interrogation_Position=1044; Antisense; AAAAATGGCTATTGACCGTTCTGCA
>probe:Drosophila_2:1623497_at:286:611; Interrogation_Position=1056; Antisense; TGACCGTTCTGCAACAAGATCCGTT
>probe:Drosophila_2:1623497_at:46:95; Interrogation_Position=1072; Antisense; AGATCCGTTGTCTTCCAAAGTAAAT
>probe:Drosophila_2:1623497_at:34:435; Interrogation_Position=1117; Antisense; GAGGTCTAATCGATTTCTGAATGGT
>probe:Drosophila_2:1623497_at:727:21; Interrogation_Position=1247; Antisense; ATATATTCGAGTGCGCTATTTTCCT
>probe:Drosophila_2:1623497_at:139:307; Interrogation_Position=1259; Antisense; GCGCTATTTTCCTACTCCAAAAGTT
>probe:Drosophila_2:1623497_at:704:657; Interrogation_Position=1287; Antisense; TAAGTTTAATATCTCGTTGCGCTCT
>probe:Drosophila_2:1623497_at:600:469; Interrogation_Position=1302; Antisense; GTTGCGCTCTCTTTATTGTTTAGCA
>probe:Drosophila_2:1623497_at:93:13; Interrogation_Position=855; Antisense; ATTAGTTACAGCTCCTTCCTGACCA
>probe:Drosophila_2:1623497_at:376:409; Interrogation_Position=885; Antisense; GACGAACTGATCGATGTGACATCCG
>probe:Drosophila_2:1623497_at:210:153; Interrogation_Position=903; Antisense; ACATCCGTCGATGGCAATGCGTTAT
>probe:Drosophila_2:1623497_at:106:565; Interrogation_Position=915; Antisense; GGCAATGCGTTATCCGAGACGGCGT
>probe:Drosophila_2:1623497_at:621:577; Interrogation_Position=982; Antisense; GGCCCTGGTAATTGGGCGTGCCCAA

Paste this into a BLAST search page for me
GCCCAATATGGATCTTATCCCTAATAAAAATGGCTATTGACCGTTCTGCATGACCGTTCTGCAACAAGATCCGTTAGATCCGTTGTCTTCCAAAGTAAATGAGGTCTAATCGATTTCTGAATGGTATATATTCGAGTGCGCTATTTTCCTGCGCTATTTTCCTACTCCAAAAGTTTAAGTTTAATATCTCGTTGCGCTCTGTTGCGCTCTCTTTATTGTTTAGCAATTAGTTACAGCTCCTTCCTGACCAGACGAACTGATCGATGTGACATCCGACATCCGTCGATGGCAATGCGTTATGGCAATGCGTTATCCGAGACGGCGTGGCCCTGGTAATTGGGCGTGCCCAA

Full Affymetrix probeset data:

Annotations for 1623497_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720