FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623499_at:

>probe:Drosophila_2:1623499_at:681:703; Interrogation_Position=1026; Antisense; TTATCAATTCTTCAGGTGTGCAAAC
>probe:Drosophila_2:1623499_at:520:61; Interrogation_Position=580; Antisense; ATGTGATGGGACTCCGGTCACAGGC
>probe:Drosophila_2:1623499_at:349:495; Interrogation_Position=596; Antisense; GTCACAGGCGCGTCTCAATACGTTT
>probe:Drosophila_2:1623499_at:316:479; Interrogation_Position=617; Antisense; GTTTCGCGAAATGTGGTACCACGTC
>probe:Drosophila_2:1623499_at:563:711; Interrogation_Position=702; Antisense; TTCACGCTCCGGAAGCACAAGTTCG
>probe:Drosophila_2:1623499_at:86:217; Interrogation_Position=720; Antisense; AAGTTCGGACGATTCTTCTCGATCC
>probe:Drosophila_2:1623499_at:231:449; Interrogation_Position=740; Antisense; GATCCTCATCCTTGTCATGGGTTTC
>probe:Drosophila_2:1623499_at:481:577; Interrogation_Position=773; Antisense; GGCCTCCAGTGGCATAATCAGCAGT
>probe:Drosophila_2:1623499_at:300:237; Interrogation_Position=788; Antisense; AATCAGCAGTGCAGTCATCGCCTTT
>probe:Drosophila_2:1623499_at:28:63; Interrogation_Position=837; Antisense; ATGTCGCCCATATACGCCATGATCT
>probe:Drosophila_2:1623499_at:416:543; Interrogation_Position=907; Antisense; GGATTCTGGCCACGCTATAGAGCAC
>probe:Drosophila_2:1623499_at:151:613; Interrogation_Position=936; Antisense; TGAAGTTTTTCATCGGCCATGGCCA
>probe:Drosophila_2:1623499_at:518:323; Interrogation_Position=980; Antisense; GCGCCCAATCCAATGTTCACAGAGT
>probe:Drosophila_2:1623499_at:725:601; Interrogation_Position=993; Antisense; TGTTCACAGAGTTCCGACTTCCAAG

Paste this into a BLAST search page for me
TTATCAATTCTTCAGGTGTGCAAACATGTGATGGGACTCCGGTCACAGGCGTCACAGGCGCGTCTCAATACGTTTGTTTCGCGAAATGTGGTACCACGTCTTCACGCTCCGGAAGCACAAGTTCGAAGTTCGGACGATTCTTCTCGATCCGATCCTCATCCTTGTCATGGGTTTCGGCCTCCAGTGGCATAATCAGCAGTAATCAGCAGTGCAGTCATCGCCTTTATGTCGCCCATATACGCCATGATCTGGATTCTGGCCACGCTATAGAGCACTGAAGTTTTTCATCGGCCATGGCCAGCGCCCAATCCAATGTTCACAGAGTTGTTCACAGAGTTCCGACTTCCAAG

Full Affymetrix probeset data:

Annotations for 1623499_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720