Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623500_at:

>probe:Drosophila_2:1623500_at:645:111; Interrogation_Position=272; Antisense; AGCAACGTCAGCAGAGCAGGGCCAA
>probe:Drosophila_2:1623500_at:617:539; Interrogation_Position=328; Antisense; GGTATTGACACCTCGAACACGAACC
>probe:Drosophila_2:1623500_at:586:169; Interrogation_Position=359; Antisense; AAAGGTACACGGACAATCGTCGCCT
>probe:Drosophila_2:1623500_at:441:237; Interrogation_Position=373; Antisense; AATCGTCGCCTTTACGAGCAGAGCG
>probe:Drosophila_2:1623500_at:135:309; Interrogation_Position=407; Antisense; CCAGTCGCCAGAGGAGCCAAGGTCA
>probe:Drosophila_2:1623500_at:262:479; Interrogation_Position=439; Antisense; GTTTACAGTGGCAACTCGACGCCAT
>probe:Drosophila_2:1623500_at:185:473; Interrogation_Position=475; Antisense; GTTCAGTATCCCAAACAACAGGCGA
>probe:Drosophila_2:1623500_at:407:71; Interrogation_Position=494; Antisense; AGGCGAACGATGAGCTGCAGCAACT
>probe:Drosophila_2:1623500_at:324:113; Interrogation_Position=530; Antisense; AGCACTTCCGCCTGATGAACACAAG
>probe:Drosophila_2:1623500_at:711:231; Interrogation_Position=557; Antisense; AATGCTTCAGTGATGTCCGCCAGGA
>probe:Drosophila_2:1623500_at:154:231; Interrogation_Position=612; Antisense; AATCATTTTCAACAACTCGGACAAG
>probe:Drosophila_2:1623500_at:247:109; Interrogation_Position=728; Antisense; AGAAGTTGCTCCAGCTGAGGCTCCA
>probe:Drosophila_2:1623500_at:174:521; Interrogation_Position=782; Antisense; GTGGCACATGTGCTCCTTTGGGAAA
>probe:Drosophila_2:1623500_at:174:561; Interrogation_Position=802; Antisense; GGAAAGAGTTGCTCACTGCGATATA

Paste this into a BLAST search page for me
AGCAACGTCAGCAGAGCAGGGCCAAGGTATTGACACCTCGAACACGAACCAAAGGTACACGGACAATCGTCGCCTAATCGTCGCCTTTACGAGCAGAGCGCCAGTCGCCAGAGGAGCCAAGGTCAGTTTACAGTGGCAACTCGACGCCATGTTCAGTATCCCAAACAACAGGCGAAGGCGAACGATGAGCTGCAGCAACTAGCACTTCCGCCTGATGAACACAAGAATGCTTCAGTGATGTCCGCCAGGAAATCATTTTCAACAACTCGGACAAGAGAAGTTGCTCCAGCTGAGGCTCCAGTGGCACATGTGCTCCTTTGGGAAAGGAAAGAGTTGCTCACTGCGATATA

Full Affymetrix probeset data:

Annotations for 1623500_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime