FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623501_at:

>probe:Drosophila_2:1623501_at:39:47; Interrogation_Position=1032; Antisense; ATCCGAGCTTATGCTGGGCAGTGAC
>probe:Drosophila_2:1623501_at:281:85; Interrogation_Position=1051; Antisense; AGTGACTACTCCCTGTTCAAGAAGG
>probe:Drosophila_2:1623501_at:89:67; Interrogation_Position=1112; Antisense; ATGGAGGACGCTGGGTCATCAACTT
>probe:Drosophila_2:1623501_at:248:99; Interrogation_Position=1151; Antisense; AGATGGCTCTGGACAGTTTCTGGAT
>probe:Drosophila_2:1623501_at:91:135; Interrogation_Position=1178; Antisense; ACGCCATGCTCTGTCTGATTGGAGA
>probe:Drosophila_2:1623501_at:608:99; Interrogation_Position=1200; Antisense; AGAGGCCTGTAAGCACTCGGACGAT
>probe:Drosophila_2:1623501_at:653:145; Interrogation_Position=1214; Antisense; ACTCGGACGATCTTTGTGGCGTTGT
>probe:Drosophila_2:1623501_at:350:451; Interrogation_Position=1266; Antisense; GATCTCTATTTGGAACGCTGACGGG
>probe:Drosophila_2:1623501_at:135:163; Interrogation_Position=1313; Antisense; AAATTGGACGCATTTTACGCAAGGT
>probe:Drosophila_2:1623501_at:640:671; Interrogation_Position=1328; Antisense; TACGCAAGGTTCTACGCATGGACAA
>probe:Drosophila_2:1623501_at:616:675; Interrogation_Position=1432; Antisense; TAGGTTCTCATCAGACAATTGCGAA
>probe:Drosophila_2:1623501_at:420:253; Interrogation_Position=1507; Antisense; CAAGCAGGTGTGATCAGCCATCGAT
>probe:Drosophila_2:1623501_at:328:467; Interrogation_Position=1541; Antisense; GTTGGGTTCCAAATCTCTAGTCAAA
>probe:Drosophila_2:1623501_at:676:639; Interrogation_Position=1556; Antisense; TCTAGTCAAACCATCCGTACACGTA

Paste this into a BLAST search page for me
ATCCGAGCTTATGCTGGGCAGTGACAGTGACTACTCCCTGTTCAAGAAGGATGGAGGACGCTGGGTCATCAACTTAGATGGCTCTGGACAGTTTCTGGATACGCCATGCTCTGTCTGATTGGAGAAGAGGCCTGTAAGCACTCGGACGATACTCGGACGATCTTTGTGGCGTTGTGATCTCTATTTGGAACGCTGACGGGAAATTGGACGCATTTTACGCAAGGTTACGCAAGGTTCTACGCATGGACAATAGGTTCTCATCAGACAATTGCGAACAAGCAGGTGTGATCAGCCATCGATGTTGGGTTCCAAATCTCTAGTCAAATCTAGTCAAACCATCCGTACACGTA

Full Affymetrix probeset data:

Annotations for 1623501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720