Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623502_at:

>probe:Drosophila_2:1623502_at:630:543; Interrogation_Position=318; Antisense; GGATATGGCTGCTAACCCAGCGATA
>probe:Drosophila_2:1623502_at:542:101; Interrogation_Position=366; Antisense; AGAGCTGTCGCTATCCCGAAGTGTA
>probe:Drosophila_2:1623502_at:186:373; Interrogation_Position=383; Antisense; GAAGTGTACACCTTGTCCACCGAGG
>probe:Drosophila_2:1623502_at:335:509; Interrogation_Position=443; Antisense; GTGCTGCGAGCTTCAAACAACAAAA
>probe:Drosophila_2:1623502_at:544:223; Interrogation_Position=503; Antisense; AAGGAGTTCTATGCCGCCTACGAAA
>probe:Drosophila_2:1623502_at:150:91; Interrogation_Position=588; Antisense; AGTACCACAAGATCATGGCCGTCGA
>probe:Drosophila_2:1623502_at:608:581; Interrogation_Position=603; Antisense; TGGCCGTCGACATATTCAACTATTT
>probe:Drosophila_2:1623502_at:254:221; Interrogation_Position=650; Antisense; AAGTGCTTCATGCATCAGCTGGATC
>probe:Drosophila_2:1623502_at:353:263; Interrogation_Position=665; Antisense; CAGCTGGATCCCGTGAATCTGGAGA
>probe:Drosophila_2:1623502_at:67:439; Interrogation_Position=695; Antisense; GAGGAATACCGCGATCTGCTCCAAA
>probe:Drosophila_2:1623502_at:408:615; Interrogation_Position=773; Antisense; TGCAAGTGTATCTACCCGATTCCAA
>probe:Drosophila_2:1623502_at:675:201; Interrogation_Position=796; Antisense; AACCTGCCCCATCTTGAAGCTGAAG
>probe:Drosophila_2:1623502_at:233:379; Interrogation_Position=811; Antisense; GAAGCTGAAGTGTTCCCACCAAAAC
>probe:Drosophila_2:1623502_at:366:61; Interrogation_Position=852; Antisense; ATGTCAGTCGCATCTAGTCAAGCCA

Paste this into a BLAST search page for me
GGATATGGCTGCTAACCCAGCGATAAGAGCTGTCGCTATCCCGAAGTGTAGAAGTGTACACCTTGTCCACCGAGGGTGCTGCGAGCTTCAAACAACAAAAAAGGAGTTCTATGCCGCCTACGAAAAGTACCACAAGATCATGGCCGTCGATGGCCGTCGACATATTCAACTATTTAAGTGCTTCATGCATCAGCTGGATCCAGCTGGATCCCGTGAATCTGGAGAGAGGAATACCGCGATCTGCTCCAAATGCAAGTGTATCTACCCGATTCCAAAACCTGCCCCATCTTGAAGCTGAAGGAAGCTGAAGTGTTCCCACCAAAACATGTCAGTCGCATCTAGTCAAGCCA

Full Affymetrix probeset data:

Annotations for 1623502_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime