FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623503_at:

>probe:Drosophila_2:1623503_at:587:679; Interrogation_Position=4282; Antisense; TATTTGTAAGTCTCGCTTCTTTTGC
>probe:Drosophila_2:1623503_at:114:695; Interrogation_Position=4302; Antisense; TTTGCTTTGCGGCATTGCTCTGCAA
>probe:Drosophila_2:1623503_at:191:619; Interrogation_Position=4317; Antisense; TGCTCTGCAACGTTCCTACTAAAAA
>probe:Drosophila_2:1623503_at:178:471; Interrogation_Position=4367; Antisense; GTTCGAATAACTCCCATTCATCACT
>probe:Drosophila_2:1623503_at:663:273; Interrogation_Position=4381; Antisense; CATTCATCACTTCAGGCAACAGTTT
>probe:Drosophila_2:1623503_at:663:565; Interrogation_Position=4395; Antisense; GGCAACAGTTTAAGTCCACAACACA
>probe:Drosophila_2:1623503_at:449:625; Interrogation_Position=4409; Antisense; TCCACAACACAATATCTGCCACGAA
>probe:Drosophila_2:1623503_at:532:217; Interrogation_Position=4490; Antisense; AAGTACTTTGTGTTGTTCGCACACC
>probe:Drosophila_2:1623503_at:319:471; Interrogation_Position=4504; Antisense; GTTCGCACACCTTTAGATCCTAAGT
>probe:Drosophila_2:1623503_at:157:15; Interrogation_Position=4562; Antisense; ATTTTGTAGTCGATCCAATCAAGGG
>probe:Drosophila_2:1623503_at:591:389; Interrogation_Position=4628; Antisense; GAAACTGAGTGTCCTTAGTACATGG
>probe:Drosophila_2:1623503_at:2:101; Interrogation_Position=4674; Antisense; AGAGTAGTACACAACACACAACACA
>probe:Drosophila_2:1623503_at:49:17; Interrogation_Position=4709; Antisense; ATTTATTCATGTACGCGTGTAACTA
>probe:Drosophila_2:1623503_at:437:185; Interrogation_Position=4760; Antisense; AAAATACTTGTATTGCTGCTGCACA

Paste this into a BLAST search page for me
TATTTGTAAGTCTCGCTTCTTTTGCTTTGCTTTGCGGCATTGCTCTGCAATGCTCTGCAACGTTCCTACTAAAAAGTTCGAATAACTCCCATTCATCACTCATTCATCACTTCAGGCAACAGTTTGGCAACAGTTTAAGTCCACAACACATCCACAACACAATATCTGCCACGAAAAGTACTTTGTGTTGTTCGCACACCGTTCGCACACCTTTAGATCCTAAGTATTTTGTAGTCGATCCAATCAAGGGGAAACTGAGTGTCCTTAGTACATGGAGAGTAGTACACAACACACAACACAATTTATTCATGTACGCGTGTAACTAAAAATACTTGTATTGCTGCTGCACA

Full Affymetrix probeset data:

Annotations for 1623503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720