Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623505_s_at:

>probe:Drosophila_2:1623505_s_at:260:545; Interrogation_Position=1001; Antisense; GGACGGACGTACTCTGTCCGACTAC
>probe:Drosophila_2:1623505_s_at:592:33; Interrogation_Position=657; Antisense; ATCACCTTGGAGGTCGAGCCATCCG
>probe:Drosophila_2:1623505_s_at:33:131; Interrogation_Position=660; Antisense; ACCTTGGAGGTCGAGCCATCCGATA
>probe:Drosophila_2:1623505_s_at:358:631; Interrogation_Position=829; Antisense; TCCTGCGTCTGCGTGGTGGCATGCA
>probe:Drosophila_2:1623505_s_at:698:621; Interrogation_Position=838; Antisense; TGCGTGGTGGCATGCAGATCTTTGT
>probe:Drosophila_2:1623505_s_at:141:453; Interrogation_Position=854; Antisense; GATCTTTGTGAAGACCCTCACTGGC
>probe:Drosophila_2:1623505_s_at:414:643; Interrogation_Position=856; Antisense; TCTTTGTGAAGACCCTCACTGGCAA
>probe:Drosophila_2:1623505_s_at:629:691; Interrogation_Position=858; Antisense; TTTGTGAAGACCCTCACTGGCAAGA
>probe:Drosophila_2:1623505_s_at:50:593; Interrogation_Position=860; Antisense; TGTGAAGACCCTCACTGGCAAGACC
>probe:Drosophila_2:1623505_s_at:631:587; Interrogation_Position=892; Antisense; TGGAGGTTGAGCCATCCGATACCAT
>probe:Drosophila_2:1623505_s_at:1:263; Interrogation_Position=969; Antisense; CAGCGTTTGATTTTCGCCGGAAAGC
>probe:Drosophila_2:1623505_s_at:135:329; Interrogation_Position=971; Antisense; GCGTTTGATTTTCGCCGGAAAGCAG
>probe:Drosophila_2:1623505_s_at:397:203; Interrogation_Position=990; Antisense; AAGCAGCTGGAGGACGGACGTACTC
>probe:Drosophila_2:1623505_s_at:588:117; Interrogation_Position=994; Antisense; AGCTGGAGGACGGACGTACTCTGTC

Paste this into a BLAST search page for me
GGACGGACGTACTCTGTCCGACTACATCACCTTGGAGGTCGAGCCATCCGACCTTGGAGGTCGAGCCATCCGATATCCTGCGTCTGCGTGGTGGCATGCATGCGTGGTGGCATGCAGATCTTTGTGATCTTTGTGAAGACCCTCACTGGCTCTTTGTGAAGACCCTCACTGGCAATTTGTGAAGACCCTCACTGGCAAGATGTGAAGACCCTCACTGGCAAGACCTGGAGGTTGAGCCATCCGATACCATCAGCGTTTGATTTTCGCCGGAAAGCGCGTTTGATTTTCGCCGGAAAGCAGAAGCAGCTGGAGGACGGACGTACTCAGCTGGAGGACGGACGTACTCTGTC

Full Affymetrix probeset data:

Annotations for 1623505_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime