FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623507_at:

>probe:Drosophila_2:1623507_at:421:43; Interrogation_Position=115; Antisense; ATCGAAATTGCCACGGGACTCCATT
>probe:Drosophila_2:1623507_at:221:629; Interrogation_Position=134; Antisense; TCCATTCAGCCGGATTGTGATCAGG
>probe:Drosophila_2:1623507_at:693:105; Interrogation_Position=169; Antisense; AGAACAGGCCCTGGTTTCGTCCGTG
>probe:Drosophila_2:1623507_at:73:297; Interrogation_Position=198; Antisense; CGACTCTTCGTCCTTTGGACTATAA
>probe:Drosophila_2:1623507_at:487:295; Interrogation_Position=233; Antisense; CGAGAGGCGCGTAAGATTCTTCTGA
>probe:Drosophila_2:1623507_at:176:241; Interrogation_Position=317; Antisense; AATAATCTCACCGATGACGACGAAG
>probe:Drosophila_2:1623507_at:433:127; Interrogation_Position=357; Antisense; AGCCAGTGCGTCTCAAGTCGACAAT
>probe:Drosophila_2:1623507_at:358:385; Interrogation_Position=410; Antisense; GAAACGCCGCGAAAAACTGAACTTG
>probe:Drosophila_2:1623507_at:346:669; Interrogation_Position=483; Antisense; TACGGCTTGTGATCATGGCTTGCAG
>probe:Drosophila_2:1623507_at:42:69; Interrogation_Position=497; Antisense; ATGGCTTGCAGCGTATGCGCTTTAA
>probe:Drosophila_2:1623507_at:431:623; Interrogation_Position=512; Antisense; TGCGCTTTAATCTATCATGGCTATT
>probe:Drosophila_2:1623507_at:469:569; Interrogation_Position=530; Antisense; GGCTATTTCCTATCGAAGATCGGCA
>probe:Drosophila_2:1623507_at:728:635; Interrogation_Position=570; Antisense; TCGAATTGTGGCGAATGCGGTGACC
>probe:Drosophila_2:1623507_at:591:217; Interrogation_Position=75; Antisense; AAGTCTATCAGTCGGTCAGTTCGCT

Paste this into a BLAST search page for me
ATCGAAATTGCCACGGGACTCCATTTCCATTCAGCCGGATTGTGATCAGGAGAACAGGCCCTGGTTTCGTCCGTGCGACTCTTCGTCCTTTGGACTATAACGAGAGGCGCGTAAGATTCTTCTGAAATAATCTCACCGATGACGACGAAGAGCCAGTGCGTCTCAAGTCGACAATGAAACGCCGCGAAAAACTGAACTTGTACGGCTTGTGATCATGGCTTGCAGATGGCTTGCAGCGTATGCGCTTTAATGCGCTTTAATCTATCATGGCTATTGGCTATTTCCTATCGAAGATCGGCATCGAATTGTGGCGAATGCGGTGACCAAGTCTATCAGTCGGTCAGTTCGCT

Full Affymetrix probeset data:

Annotations for 1623507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720